Prev. |  KEGG KO K02726 > 

RIKEN DNA Bank Human Resource - PSMA2

Gene ID NCBI Gene 5683 |  KEGG hsa:5683
Gene Symbol PSMA2
Protein Name proteasome subunit alpha 2
Synonyms HC3|MU|PMSA2|PSC2
Ortholog resources KEGG ortholog (KEGG orthology K02726) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039393 IRAK098I01 pCMV-SPORT6 BC047697 NM_002787 Full
HGY086301 IRAL015M13 pOTB7 BC002900 NM_002787 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042458 ARe06C10 pKA1U5 NM_002787.4  
TGGTGTGCTTTGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACT
HKR055673 ARe39D01 pKA1U5 NM_002787.4  
GGTGCTTTGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACA
HKR060505 ARe51E09 pKA1U5 NM_002787.4  
TGGGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAG
HKR076404 ARe91A04 pKA1U5 NM_002787.4  
GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC
HKR170056 ARi25C08 pGCAP10 NM_002787.4  
GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC
HKR247346 ARiS118G02 pGCAP10 NM_002787.4  
GTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGT
HKR260201 ARiS150I09 pGCAP10 NM_002787.4  
GTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGT
HKR338878 RBb47D06 pGCAP1 NM_002787.4  
GTCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCC
HKR342104 RBb55E08 pGCAP1 NM_002787.4  
HKR366532 RBd16F12 pGCAP10 NM_002787.4  
GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC
HKR386124 RBd65F04 pGCAP10 NM_002787.4  
GNNGCTTTGGCTCTTCGGGTAAAGATGGCGGACCGCGGGTACAGCTTTTCGCTGACTACN
HKR392499 RBd81E03 pGCAP10 NM_002787.4  
GGTGCTTTGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACA
HKR394077 RBd85D05 pGCAP10 NM_002787.4  
GTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGT
HKR394921 RBd87F01 pGCAP10 NM_002787.4  
GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl