Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00509

HP ID(1) HP00509
Gene ID(2) 5690
Gene Symbol finder PSMB2
Protein Name proteasome (prosome, macropain) subunit, beta type, 2
RefSeq NM_002794.3
Length of RefSeq (bp) 850
Chromosome 1p34.2
Reference DDBJ accession
UniGene Hs.471441

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03C01 pKA1U5 TGGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTC
ARe18D08 pKA1U5 GGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCT
ARe67G09 pKA1U5 GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
ARi14G10 pGCAP10 GGCAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCG
ARi56D09 pGCAP10 GGGAAGTCGTGCTGCAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGA
RBb64C09 pGCAP1 GAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGC
RBb69D12 pGCAP1 GGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCGGACCTGC
RBd03E02 pGCAP10 GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
RBd43F03 pGCAP10 GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
RBd77G04 pGCAP10 GATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCT
RBd82G07 pGCAP10 GAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGG
RBdS007B17 pGCAP10 GGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCGGACCTGCAGCCCCTGGCCTTCCGC
RBdS075H17 pGCAP10 GGAGAGCGCCGTGGAAGTCGTGCTGCAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGT
RBdS083G17 pGCAP10 GGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCT
RBdS104K04 pGCAP10 GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
RBdS156E03 pGCAP10 GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl