Prev. |  KEGG KO K02734 > 

RIKEN DNA Bank Human Resource - PSMB2

Gene ID NCBI Gene 5690 |  KEGG hsa:5690
Gene Symbol PSMB2
Protein Name proteasome 20S subunit beta 2
Synonyms HC7-I
Ortholog resources KEGG ortholog (KEGG orthology K02734) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041249 ARe03C01 pKA1U5 NM_002794.3  
TGGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTC
HKR047280 ARe18D08 pKA1U5 NM_002794.3  
GGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCT
HKR066953 ARe67G09 pKA1U5 NM_002794.3  
GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
HKR165754 ARi14G10 pGCAP10 NM_002794.3  
GGCAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCG
HKR182481 ARi56D09 pGCAP10 NM_002794.3  
GGGAAGTCGTGCTGCAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGA
HKR345657 RBb64C09 pGCAP1 NM_002794.3  
GAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGC
HKR347684 RBb69D12 pGCAP1 NM_002794.3  
GGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCGGACCTGC
HKR361298 RBd03E02 pGCAP10 NM_002794.3  
GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
HKR377323 RBd43F03 pGCAP10 NM_002794.3  
GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
HKR390948 RBd77G04 pGCAP10 NM_002794.3  
GATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCT
HKR392951 RBd82G07 pGCAP10 NM_002794.3  
GAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGG
HKR402841 RBdS007B17 pGCAP10 NM_002794.3  
GGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCGGACCTGCAGCCCCTGGCCTTCCGC
HKR430185 RBdS075H17 pGCAP10 NM_002794.3  
GGAGAGCGCCGTGGAAGTCGTGCTGCAGGCGTCGCGCCAATCTTCGCTCTGAGGTGCTGT
HKR433361 RBdS083G17 pGCAP10 NM_002794.3  
GGCGCCAATCTTCGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCT
HKR441844 RBdS104K04 pGCAP10 NM_002794.3  
GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG
HKR462499 RBdS156E03 pGCAP10 NM_002794.3  
GGCTCTGAGGTGCTGTCTCACCGGTGAGACCTGGAAGCGGGCGAGTCTCGTGCTGTGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl