Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00496

HP ID(1) HP00496
Gene ID(2) 4710
Gene Symbol finder NDUFB4
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
RefSeq NM_004547.4
Length of RefSeq (bp) 541
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.304613

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi20C11 pGCAP10 GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
ARi54E08 pGCAP10 AGCTCAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTA
ARiS161I15 pGCAP10 GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
RBb20E11 pKA1U5 GGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAG
RBb32A05 pGCAP1 GAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAG
RBb33F05 pGCAP1 TTGAGACCCTCGACCCAGCCGAATACAACATATCTCCGGAAACCCGGCGGGCGCAAGCCG
RBb61G12 pGCAP1 TGGCACTTCCTGAAGCTGAAGGTCAGCATAGACAAAGGGCCTCAGAATCGCGCAGGCGCA
RBd04G11 pGCAP10 GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
RBd10E08 pGCAP10 GCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTG
RBd24E04 pGCAP10 GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
RBd43C03 pGCAP10 CCTCAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTAT
RBd43D01 pGCAP10 GCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCT
RBd73A07 pGCAP10 GAGAATCNNNNAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAG
RBd84B03 pGCAP10 GGCAGGCGCAATTGNGCCCTGGTTCGCCAAGATGNCNTTCCCNAANNATAANCCGNCGAG
RBdS013I01 pGCAP10 GGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAGA
RBdS022I06 pGCAP10 GCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTG
RBdS022O20 pGCAP10 GCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTG
RBdS070F10 pGCAP10 GGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAGA
RBdS104F21 pGCAP10 GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
RBdS104H06 pGCAP10 GAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCA
RBdS132E01 pGCAP10 GAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCC
RBdS132E12 pGCAP10 GAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl