Prev. |  KEGG KO K03960 > 

RIKEN DNA Bank Human Resource - NDUFB4

Gene ID NCBI Gene 4710 |  KEGG hsa:4710
Gene Symbol NDUFB4
Protein Name NADH:ubiquinone oxidoreductase subunit B4
Synonyms B15|CI-B15
Ortholog resources KEGG ortholog (KEGG orthology K03960) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001662 IRAK004C14 pCMV-SPORT6 BC000855 NM_004547 Full
HGX021082 IRAK052L18 pCMV-SPORT6 BC034579 NM_004547 Partial
HGY103101 IRAL057M13 pDNR-LIB BC070285 NM_004547 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168059 ARi20C11 pGCAP10 NM_004547.4  
GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
HKR181704 ARi54E08 pGCAP10 NM_004547.4  
AGCTCAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTA
HKR264607 ARiS161I15 pGCAP10 NM_004547.4  
GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
HKR328107 RBb20E11 pKA1U5 NM_004547.4  
GGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAG
HKR332805 RBb32A05 pGCAP1 NM_004547.4  
GAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAG
HKR333325 RBb33F05 pGCAP1 NM_004547.4  
TTGAGACCCTCGACCCAGCCGAATACAACATATCTCCGGAAACCCGGCGGGCGCAAGCCG
HKR344556 RBb61G12 pGCAP1 NM_004547.4  
TGGCACTTCCTGAAGCTGAAGGTCAGCATAGACAAAGGGCCTCAGAATCGCGCAGGCGCA
HKR361755 RBd04G11 pGCAP10 NM_004547.4  
GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
HKR364104 RBd10E08 pGCAP10 NM_004547.4  
GCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTG
HKR369700 RBd24E04 pGCAP10 NM_004547.4  
GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
HKR377251 RBd43C03 pGCAP10 NM_004547.4  
CCTCAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTAT
HKR377273 RBd43D01 pGCAP10 NM_004547.4  
GCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCT
HKR389207 RBd73A07 pGCAP10 NM_004547.4  
GAGAATCNNNNAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAG
HKR393627 RBd84B03 pGCAP10 NM_004547.4  
GGCAGGCGCAATTGNGCCCTGGTTCGCCAAGATGNCNTTCCCNAANNATAANCCGNCGAG
HKR405393 RBdS013I01 pGCAP10 NM_004547.4  
GGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAGA
HKR408998 RBdS022I06 pGCAP10 NM_004547.4  
GCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTG
HKR409156 RBdS022O20 pGCAP10 NM_004547.4  
GCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTG
HKR428130 RBdS070F10 pGCAP10 NM_004547.4  
GGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAGA
HKR441741 RBdS104F21 pGCAP10 NM_004547.4  
GGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCG
HKR441774 RBdS104H06 pGCAP10 NM_004547.4  
GAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCA
HKR452897 RBdS132E01 pGCAP10 NM_004547.4  
GAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAGCCGTCGAGCC
HKR452908 RBdS132E12 pGCAP10 NM_004547.4  
GAGAATCGCGCAGGCGCAATTGTGCCCTGGTTCGCCAAGATGTCGTTCCCAAAGTATAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl