Prev. | NRCD Clone Q | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00495

HP ID(1) HP00495
Gene ID(2) 5859
Gene Symbol finder QARS
Protein Name glutaminyl-tRNA synthetase
RefSeq NM_005051.1
Length of RefSeq (bp) 2437
Chromosome 3p21.31
Reference DDBJ accession
UniGene Hs.79322

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46D10 pKA1U5 GCTTTTTTTAGTTTCCGGTGTCTCTGCAATGGCGGCTCTAGACTCCCTGTCGCTCTTCAC
RBdS177A01 pGCAP10 GNTTTTNNTTTCCNGNNTCTCTGCAATGACNNCTCTAGANTCCCTGTCGCTCTTNNCTAG
RBdS154G11 pGCAP10 GAGNGNCNGGTGGCTNNNNTGGGTGAGCTNGTNTGTGTNNNTGNGGGTGGACGNGNTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl