Prev. |  KEGG KO K01886 > 

RIKEN DNA Bank Human Resource - QARS1

Gene ID NCBI Gene 5859 |  KEGG hsa:5859
Gene Symbol QARS1
Protein Name glutaminyl-tRNA synthetase 1
Synonyms GLNRS|MSCCA|PRO2195|QARS
Ortholog resource in our bank

  QARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001753 IRAK004G09 pCMV-SPORT6 BC001567 NM_005051 Full
HGX008440 IRAK021B16 pCMV-SPORT6 BC029739 NM_005051 Full
HGX010545 IRAK026G01 pCMV-SPORT6 BC016634 NM_005051 Partial/var
HGY080556 IRAL001G12 pOTB7 BC000394 NM_005051 Full
HGY083504 IRAL008M16 pOTB7 BC001772 NM_005051 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091627 M01C029B03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091675 M01C029D03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091723 M01C029F03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091771 M01C029H03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091819 M01C029J03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091867 M01C029L03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091915 M01C029N03 pDONR221 MGC04-C02 BC001567 NM_005051  
HGE091963 M01C029P03 pDONR221 MGC04-C02 BC001567 NM_005051  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058482 ARe46D10 pKA1U5 NM_005051.1  
GCTTTTTTTAGTTTCCGGTGTCTCTGCAATGGCGGCTCTAGACTCCCTGTCGCTCTTCAC
HKR461755 RBdS154G11 pGCAP10 NM_005051.1  
GAGNGNCNGGTGGCTNNNNTGGGTGAGCTNGTNTGTGTNNNTGNGGGTGGACGNGNTTGG
HKR470801 RBdS177A01 pGCAP10 NM_005051.1  
GNTTTTNNTTTCCNGNNTCTCTGCAATGACNNCTCTAGANTCCCTGTCGCTCTTNNCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl