Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00485

HP ID(1) HP00485
Gene ID(2) 7167
Gene Symbol finder TPI1
Protein Name triosephosphate isomerase 1
RefSeq NM_000365.4
Length of RefSeq (bp) 1254
Chromosome 12p13
Reference DDBJ accession
UniGene Hs.524219

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25D06 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARe25D07 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARe47H04 pKA1U5 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARe48H08 pKA1U5 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARe50E07 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARe63B04 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARe71A11 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARe72B07 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARe72D03 pKA1U5 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARe73E04 pKA1U5 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGACGCCCTCCAGGAAGTTCTTC
ARe77D02 pKA1U5 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCNTGNCGCCCTCCAGGGAAGTTCTTC
ARe83E05 pKA1U5 GGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCT
ARe86F04 pKA1U5 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARe99A09 pKA1U5 GGACACTGCACCTTCAGCGCCTCGGCTCCAGCGCCNTNGNGCCCTCCAGGAAGTTCTTCG
ARe99E02 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi09D07 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARi10C04 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARi13H07 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi14G06 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi17G09 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi18F11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi20H01 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi30D07 pGCAP10 AAGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
ARi39D10 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi39E03 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARi42F10 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi45C04 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi58E12 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCNGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARi60E08 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARi68H11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARiS008J04 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARiS020L11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARiS049E24 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARiS055C17 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARiS087G06 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARiS096C08 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARiS096J24 pGCAP10 CGGCCGGCCGATGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTC
ARiS109E19 pGCAP10 GGACACTGNNCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCGT
ARiS109J08 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARiS118K11 pGCAP10 GGCAGACACTGACCTTCNNCNCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
ARiS118P23 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARiS161K06 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
ARiS194M04 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBb02A05 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb05H07 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb06H09 pKA1U5 TGGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
RBb10E07 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb13E02 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCNATGGCGCCCTCCAGGAAGTTCTT
RBb13H03 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb16C06 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb17F12 pKA1U5 GAGACANTGCACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCANGAAGTTCTTC
RBb21F11 pKA1U5 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb26D09 pGCAP1 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb35D09 pGCAP1 ATAAGGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCT
RBb35F01 pGCAP1 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBb44B08 pGCAP1 TGCANACACTGCNCCTTCAGNCGCCTCGGANTCCAGACGCCATGGTCGCCCTTCTCAGG
RBb48H08 pGCAP1 GGCAGAACACTGAACCTTCAGCGCCTCGNCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
RBb50B09 pGCAP1 TGGCAGACACTGAACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
RBb60F02 pGCAP1 TTTGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTT
RBb65A10 pGCAP1 AATATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACA
RBd20B12 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd27B11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd31C09 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd33A09 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd46A05 pGCAP10 TGAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTC
RBd54A09 pGCAP10 TGGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCNNNNCTCCAGGAAGTT
RBd61B05 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd61C05 pGCAP10 GGCAGACCCTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCANGAAGTTCTT
RBd62B08 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd63G06 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBd65D03 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd70H06 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBd76A10 pGCAP10 GGCANACNNTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd76D04 pGCAP10 GGGCAGACACGGACCNNCAGCGCCCCGGCCCCAGCGCCAGGGCGCCCCCCAGGAAGNCCC
RBd78A11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd79H03 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd81E06 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd85F02 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd91E11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd97B11 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBd98C10 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS007M02 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS007M16 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS013M03 pGCAP10 GGCAGNCACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS014A02 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS014M24 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS040G10 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS051D22 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS051O23 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCN
RBdS070O12 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS070P12 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS083O17 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS104D06 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS154D06 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
RBdS187H21 pGCAP10 GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
RBdS187M03 pGCAP10 GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl