Prev. |  KEGG KO K01803 > 

RIKEN DNA Bank Human Resource - TPI1

Gene ID NCBI Gene 7167 |  KEGG hsa:7167
Gene Symbol TPI1
Protein Name triosephosphate isomerase 1
Synonyms HEL-S-49|TIM|TPI|TPID
Ortholog resource in our bank

  TPI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006130 IRAK015F10 pCMV-SPORT6 BC017165 NM_000365 Partial
HGY086308 IRAL015M20 pOTB7 BC011611 NM_000365 Full
HGY088261 IRAL020K21 pOTB7 BC007812 NM_000365 Full
HGY088687 IRAL021L23 pDNR-LIB BC007086 NM_000365 Full
HGY090554 IRAL026G10 pOTB7 BC009329 NM_000365
HGY092481 IRAL031D09 pDNR-LIB BC015100 NM_000365 Full
HGY094471 IRAL036C23 pDNR-LIB BC017917 NM_000365 Full/var
HGY103110 IRAL057M22 pDNR-LIB BC070129 NM_000365 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050078 ARe25D06 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR050079 ARe25D07 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR058972 ARe47H04 pKA1U5 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR059376 ARe48H08 pKA1U5 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR060103 ARe50E07 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR065228 ARe63B04 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR068411 ARe71A11 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR068831 ARe72B07 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR068875 ARe72D03 pKA1U5 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR069300 ARe73E04 pKA1U5 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGACGCCCTCCAGGAAGTTCTTC
HKR070874 ARe77D02 pKA1U5 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCNTGNCGCCCTCCAGGGAAGTTCTTC
HKR073301 ARe83E05 pKA1U5 NM_000365.4  
GGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCT
HKR074524 ARe86F04 pKA1U5 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR079609 ARe99A09 pKA1U5 NM_000365.4  
GGACACTGCACCTTCAGCGCCTCGGCTCCAGCGCCNTNGNGCCCTCCAGGAAGTTCTTCG
HKR079698 ARe99E02 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR163679 ARi09D07 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR164052 ARi10C04 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR165375 ARi13H07 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR165750 ARi14G06 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR166953 ARi17G09 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR167331 ARi18F11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR168169 ARi20H01 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR172079 ARi30D07 pGCAP10 NM_000365.4  
AAGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
HKR175682 ARi39D10 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR175699 ARi39E03 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR176930 ARi42F10 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR178052 ARi45C04 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR183308 ARi58E12 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCNGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR184104 ARi60E08 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR187379 ARi68H11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR203420 ARiS008J04 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR208275 ARiS020L11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR219720 ARiS049E24 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR222065 ARiS055C17 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR234950 ARiS087G06 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR238456 ARiS096C08 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR238640 ARiS096J24 pGCAP10 NM_000365.4  
CGGCCGGCCGATGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTC
HKR243715 ARiS109E19 pGCAP10 NM_000365.4  
GGACACTGNNCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCGT
HKR243824 ARiS109J08 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR247451 ARiS118K11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCNNCNCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR247583 ARiS118P23 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR264646 ARiS161K06 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR277892 ARiS194M04 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR320805 RBb02A05 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR322175 RBb05H07 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR322577 RBb06H09 pKA1U5 NM_000365.4  
TGGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
HKR324103 RBb10E07 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR325298 RBb13E02 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCNATGGCGCCCTCCAGGAAGTTCTT
HKR325371 RBb13H03 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR326454 RBb16C06 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR326932 RBb17F12 pKA1U5 NM_000365.4  
GAGACANTGCACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCANGAAGTTCTTC
HKR328531 RBb21F11 pKA1U5 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR330481 RBb26D09 pGCAP1 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR334081 RBb35D09 pGCAP1 NM_000365.4  
ATAAGGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCT
HKR334121 RBb35F01 pGCAP1 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR337632 RBb44B08 pGCAP1 NM_000365.4  
TGCANACACTGCNCCTTCAGNCGCCTCGGANTCCAGACGCCATGGTCGCCCTTCTCAGG
HKR339376 RBb48H08 pGCAP1 NM_000365.4  
GGCAGAACACTGAACCTTCAGCGCCTCGNCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
HKR340033 RBb50B09 pGCAP1 NM_000365.4  
TGGCAGACACTGAACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTC
HKR344122 RBb60F02 pGCAP1 NM_000365.4  
TTTGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTT
HKR368036 RBd20B12 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR370835 RBd27B11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR372457 RBd31C09 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR373209 RBd33A09 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR378405 RBd46A05 pGCAP10 NM_000365.4  
TGAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTC
HKR381609 RBd54A09 pGCAP10 NM_000365.4  
TGGGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCNNNNCTCCAGGAAGTT
HKR384429 RBd61B05 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR384453 RBd61C05 pGCAP10 NM_000365.4  
GGCAGACCCTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCANGAAGTTCTT
HKR384832 RBd62B08 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR385350 RBd63G06 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR386075 RBd65D03 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR388174 RBd70H06 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR390410 RBd76A10 pGCAP10 NM_000365.4  
GGCANACNNTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR390476 RBd76D04 pGCAP10 NM_000365.4  
GGGCAGACACGGACCNNCAGCGCCCCGGCCCCAGCGCCAGGGCGCCCCCCAGGAAGNCCC
HKR391211 RBd78A11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR391771 RBd79H03 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR392502 RBd81E06 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR394122 RBd85F02 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR396507 RBd91E11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR398835 RBd97B11 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR399258 RBd98C10 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR403090 RBdS007M02 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR403104 RBdS007M16 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR405491 RBdS013M03 pGCAP10 NM_000365.4  
GGCAGNCACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR405602 RBdS014A02 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR405912 RBdS014M24 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR416154 RBdS040G10 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR420494 RBdS051D22 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR420759 RBdS051O23 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCN
HKR428348 RBdS070O12 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR428372 RBdS070P12 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR433553 RBdS083O17 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR441678 RBdS104D06 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR461678 RBdS154D06 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT
HKR474989 RBdS187H21 pGCAP10 NM_000365.4  
GAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCG
HKR475091 RBdS187M03 pGCAP10 NM_000365.4  
GGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl