Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00462

HP ID(1) HP00462
Gene ID(2) 5876
Gene Symbol finder RABGGTB
Protein Name Rab geranylgeranyltransferase, beta subunit
RefSeq NM_004582.2
Length of RefSeq (bp) 1526
Chromosome 1p31
Reference DDBJ accession
UniGene Hs.78948

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13H02 pKA1U5 GCCTTTCCCTGTTAGACATGGGCACTCCACAGAAGGATGTTATTATCAAGTCAGATGCAC
ARf03F12 pKA1U5 GCCTTTCCCTGTTAGACATGGGCACTCCACAGAAGGATGTTATTATCAAGTCAGATGCAC
RBb31D04 pGCAP1
RBb43D08 pGCAP1 TGTTTTCCCTGNTTAGACATGGGCACTCCACAGAAGGATGTTATTATCAAGTCAGATGCA
RBb57C07 pGCAP1 AAAGCGCTTTCCCTGNTTAGACATGGGCACTCCACAGAAGGATGTTATTATCAAGTCAGA
RBd58H11 pGCAP10 GGCTCTCTCCTTTCCCTGTTAGACATGTGACTGCAGTGTACTCTNAATGAGGAAGATATA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl