Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00445

HP ID(1) HP00445
Gene ID(2) 3856
Gene Symbol finder KRT8
Protein Name keratin 8
RefSeq NM_002273.3
Length of RefSeq (bp) 1802
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.533782

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08H12 pKA1U5 GATTCCTGAGAGCTCTCCTCACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCC
ARe20H07 pKA1U5 ATCCTGTGGCTCACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGG
ARe28A08 pKA1U5 GATTCCTGAGAGCTCTCCTCACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCC
ARe28E07 pKA1U5 GACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
ARe39A12 pKA1U5 ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARe45A07 pKA1U5 GACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
ARe61C08 pKA1U5 GACCAAGAAGCAGCTTTCTCCGCTCCTTCTAGGATCTCTGCCTGGTTCGGCCCGCCTGCC
ARe69B12 pKA1U5 GACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
ARe78B01 pKA1U5 GACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
ARe85B07 pKA1U5 ATCCTGACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCC
ARf03D06 pKA1U5 ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARf05G06 pKA1U5 GATTCCTGAGAGCTCTCCTCACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCC
ARi10E04 pGCAP10 ACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARi16B03 pGCAP10 GACCAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARi36A04 pGCAP10 ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARiS020H01 pGCAP10 ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARiS055D19 pGCAP10 TGGACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGC
ARiS055P08 pGCAP10 ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
ARiS087M02 pGCAP10 TGNCCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCC
ARiS118N09 pGCAP10 GACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl