Prev. |  KEGG KO K07605 > 

RIKEN DNA Bank Human Resource - KRT8

Gene ID NCBI Gene 3856 |  KEGG hsa:3856
Gene Symbol KRT8
Protein Name keratin 8
Synonyms CARD2|CK-8|CK8|CYK8|K2C8|K8|KO
Ortholog resources KEGG ortholog (KEGG orthology K07605) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001204 IRAK003A04 pCMV-SPORT6 BC008200 NM_002273 Partial
HGX001262 IRAK003C14 pCMV-SPORT6 BC011373 NM_002273 Partial
HGX053667 IRAK134C19 pCMV-SPORT6 BC063513 NM_002273 Full
HGY082040 IRAL005B16 pOTB7 BC000654 NM_002273 Full
HGY103210 IRAL058A10 pOTB7 BC073760 NM_002273 Full/var
HGY103456 IRAL058K16 pOTB7 BC075839 NM_002273 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE121220 M01C103A20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121268 M01C103C20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121316 M01C103E20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121364 M01C103G20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121412 M01C103I20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121460 M01C103K20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121508 M01C103M20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE121556 M01C103O20 pDONR221 06_12-B10 BC008200 NM_002273  
HGE125233 M01C113B09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125281 M01C113D09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125329 M01C113F09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125377 M01C113H09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125425 M01C113J09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125473 M01C113L09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125521 M01C113N09 pDONR221 06-2_05-C05 BC008200 NM_002273  
HGE125569 M01C113P09 pDONR221 06-2_05-C05 BC008200 NM_002273  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015231 W01A038B07 pENTR-TOPO IRAL058A10 BC073760 NM_002273  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043380 ARe08H12 pKA1U5 NM_002273.3  
GATTCCTGAGAGCTCTCCTCACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCC
HKR048175 ARe20H07 pKA1U5 NM_002273.3  
ATCCTGTGGCTCACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGG
HKR051208 ARe28A08 pKA1U5 NM_002273.3  
GATTCCTGAGAGCTCTCCTCACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCC
HKR051303 ARe28E07 pKA1U5 NM_002273.3  
GACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
HKR055612 ARe39A12 pKA1U5 NM_002273.3  
ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR058007 ARe45A07 pKA1U5 NM_002273.3  
GACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
HKR064456 ARe61C08 pKA1U5 NM_002273.3  
GACCAAGAAGCAGCTTTCTCCGCTCCTTCTAGGATCTCTGCCTGGTTCGGCCCGCCTGCC
HKR067636 ARe69B12 pKA1U5 NM_002273.3  
GACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
HKR071225 ARe78B01 pKA1U5 NM_002273.3  
GACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT
HKR074031 ARe85B07 pKA1U5 NM_002273.3  
ATCCTGACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCC
HKR081278 ARf03D06 pKA1U5 NM_002273.3  
ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR082150 ARf05G06 pKA1U5 NM_002273.3  
GATTCCTGAGAGCTCTCCTCACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCC
HKR164100 ARi10E04 pGCAP10 NM_002273.3  
ACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR166427 ARi16B03 pGCAP10 NM_002273.3  
GACCAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR174404 ARi36A04 pGCAP10 NM_002273.3  
ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR208169 ARiS020H01 pGCAP10 NM_002273.3  
ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR222091 ARiS055D19 pGCAP10 NM_002273.3  
TGGACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGC
HKR222368 ARiS055P08 pGCAP10 NM_002273.3  
ACCAAGAAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCTC
HKR235090 ARiS087M02 pGCAP10 NM_002273.3  
TGNCCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCC
HKR247521 ARiS118N09 pGCAP10 NM_002273.3  
GACCAAGCAGCAGCTTCTCCGCTCCTTCTAGGATCTCCGCCTGGTTCGGCCCGCCTGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl