Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00441

HP ID(1) HP00441
Gene ID(2) 374291
Gene Symbol finder NDUFS7
Protein Name NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
RefSeq NM_024407.4
Length of RefSeq (bp) 799
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.211914

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28B11 pKA1U5 GGTCTGAAGGCCGAGGCCAANATGGCGGTGCTGTCAGCATCCTGGCCTGCGCGGCTTCCG
ARiS020G17 pGCAP10 CGGCCGGCCGATGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTT
RBb08B12 pKA1U5 GGGACCTCAGAGGTTGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCC
RBd05C01 pGCAP10 TGGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCCG
RBd26C03 pGCAP10 GGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCCGG
RBd83E08 pGCAP10 GAACGGACCTCAGAGGTTGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTG
RBdS040B17 pGCAP10 GGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCNNG
RBdS132D15 pGCAP10 GAGAGGTTGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGG
RBdS154O20 pGCAP10 GAANGANANCNNACCTCTTANGNAGTCTGANGGCCNAGGCCAANATGGNGGTGCTGNCNC
RBdS187H19 pGCAP10 GGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCCGGATCCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl