Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFS7

Gene ID (NCBI) 374291
Gene Symbol NDUFS7
Protein Name NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Synonyms CI-20|CI-20KD|MY017|PSST
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082436 IRAL006B12 pOTB7 BC001715 NM_024407 Partial/var
HGY088660 IRAL021K20 pDNR-LIB BC005954 NM_024407

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE096436 M01C041B12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096484 M01C041D12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096532 M01C041F12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096580 M01C041H12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096628 M01C041J12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096676 M01C041L12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096724 M01C041N12 pDONR221 MGC10-D06 BC005954 ENST00000233627
HGE096772 M01C041P12 pDONR221 MGC10-D06 BC005954 ENST00000233627

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE014093 W01A035D21 pENTR-TOPO flj0074d20 AK127759 NM_024407

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR051235 ARe28B11 pKA1U5 NM_024407.4
GGTCTGAAGGCCGAGGCCAANATGGCGGTGCTGTCAGCATCCTGGCCTGCGCGGCTTCCG
HKR208161 ARiS020G17 pGCAP10 NM_024407.4
CGGCCGGCCGATGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTT
HKR323236 RBb08B12 pKA1U5 NM_024407.4
GGGACCTCAGAGGTTGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCC
HKR362049 RBd05C01 pGCAP10 NM_024407.4
TGGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCCG
HKR370451 RBd26C03 pGCAP10 NM_024407.4
GGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCCGG
HKR393304 RBd83E08 pGCAP10 NM_024407.4
GAACGGACCTCAGAGGTTGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTG
HKR416041 RBdS040B17 pGCAP10 NM_024407.4
GGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCNNG
HKR452887 RBdS132D15 pGCAP10 NM_024407.4
GAGAGGTTGTCTGAAGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGG
HKR461956 RBdS154O20 pGCAP10 NM_024407.4
GAANGANANCNNACCTCTTANGNAGTCTGANGGCCNAGGCCAANATGGNGGTGCTGNCNC
HKR474987 RBdS187H19 pGCAP10 NM_024407.4
GGGCCGAGGCCAAGATGGCGGTGCTGTCAGCTCCTGGCCTGCGCGGCTTCCGGATCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.06

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl