Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00418

HP ID(1) HP00418
Gene ID(2) 7388
Gene Symbol finder UQCRH
Protein Name ubiquinol-cytochrome c reductase hinge protein
RefSeq NM_006004.2
Length of RefSeq (bp) 546
Chromosome 1p33
Reference DDBJ accession
UniGene Hs.481571

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi04H11 pGCAP10 GAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAG
ARi39D02 pGCAP10 GGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCG
ARiS087F18 pGCAP10 GCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGA
ARiS118P09 pGCAP10 GCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACC
ARiS122K14 pGCAP10 GCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAAC
ARiS191K14 pGCAP10 GCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACC
RBb29F02 pGCAP1 CAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTA
RBb32F06 pGCAP1 GAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTC
RBb60G02 pGCAP1 GGTGTTGGAGTGACCCTTACAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTG
RBb60H02 pGCAP1 GGTGTTGGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTT
RBb70G12 pGCAP1 GGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCG
RBd15G05 pGCAP10 GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
RBd31E11 pGCAP10 GGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAGGACGAGCAAAAGATGCTTAC
RBd38B08 pGCAP10 GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
RBd52D01 pGCAP10 GAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAG
RBd69A04 pGCAP10 GGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCG
RBd82C01 pGCAP10 GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
RBdS081B01 pGCAP10 GGACCATTGCGTGGCCCACAAACTCTTTAACAACTTGAAATAAATGTGTGGACTTAATTC
RBdS132N10 pGCAP10 GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
RBdS156A22 pGCAP10 GATCGCCGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl