Prev. |  KEGG KO K00416 > 

RIKEN DNA Bank Human Resource - UQCRH

Gene ID NCBI Gene 7388 |  KEGG hsa:7388
Gene Symbol UQCRH
Protein Name ubiquinol-cytochrome c reductase hinge protein
Synonyms QCR6|UQCR8
Ortholog resources KEGG ortholog (KEGG orthology K00416) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009001 IRAK022I09 pCMV-SPORT6 BC015177 NM_006004 Full
HGY081910 IRAL004M22 pOTB7 BC001426 NM_006004 Full
HGY083754 IRAL009G10 pOTB7 BC001934 NM_006004

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161779 ARi04H11 pGCAP10 NM_006004.2  
GAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAG
HKR175674 ARi39D02 pGCAP10 NM_006004.2  
GGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCG
HKR234938 ARiS087F18 pGCAP10 NM_006004.2  
GCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGA
HKR247569 ARiS118P09 pGCAP10 NM_006004.2  
GCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACC
HKR249054 ARiS122K14 pGCAP10 NM_006004.2  
GCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAAC
HKR276654 ARiS191K14 pGCAP10 NM_006004.2  
GCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACC
HKR331722 RBb29F02 pGCAP1 NM_006004.2  
CAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTA
HKR332926 RBb32F06 pGCAP1 NM_006004.2  
GAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCTC
HKR344146 RBb60G02 pGCAP1 NM_006004.2  
GGTGTTGGAGTGACCCTTACAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTG
HKR344170 RBb60H02 pGCAP1 NM_006004.2  
GGTGTTGGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTT
HKR348156 RBb70G12 pGCAP1 NM_006004.2  
GGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCG
HKR366149 RBd15G05 pGCAP10 NM_006004.2  
GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
HKR372507 RBd31E11 pGCAP10 NM_006004.2  
GGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAGGACGAGCAAAAGATGCTTAC
HKR375232 RBd38B08 pGCAP10 NM_006004.2  
GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
HKR380873 RBd52D01 pGCAP10 NM_006004.2  
GAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAG
HKR387604 RBd69A04 pGCAP10 NM_006004.2  
GGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCG
HKR392849 RBd82C01 pGCAP10 NM_006004.2  
GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
HKR432425 RBdS081B01 pGCAP10 NM_006004.2  
GGACCATTGCGTGGCCCACAAACTCTTTAACAACTTGAAATAAATGTGTGGACTTAATTC
HKR453122 RBdS132N10 pGCAP10 NM_006004.2  
GGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAGGTGCCGCTGTTGCTGCT
HKR462422 RBdS156A22 pGCAP10 NM_006004.2  
GATCGCCGGATTTCCGCTGAGTGACCCTTACAAGTCCTTCTTGATCCTGAACTGGGTTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl