Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00405

HP ID(1) HP00405
Gene ID(2) 4723
Gene Symbol finder NDUFV1
Protein Name NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
RefSeq NM_007103.3
Length of RefSeq (bp) 1631
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.7744

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01F08 pKA1U5 GGCCAGTTCCTCAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACCCATCTGGCCCG
ARe54G12 pKA1U5 GGTCTCTATCGCGCCAGTTCCTCAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACC
ARe94B05 pKA1U5 TTGAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACCCATCTGGCCCGCCGCGATGC
ARi60A02 pGCAP10 GCCTGCGCGCCACCTAGCGTCTCTATCGCGCCAGTTCCTCAGCCTCAGTGCTATGAAGGT
ARiS085C12 pGCAP10 GGCCAGTTCCTCAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACCCATCTGGCCCG
RBdS132G04 pGCAP10 GAGCCTAGGATTCCGTGACAGGCCCTCTGGGAAGAACTCCGCGAACAACCCCCTGCCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl