Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFV1

Gene ID (NCBI) 4723
Gene Symbol NDUFV1
Protein Name NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Synonyms CI-51K|CI51KD|UQOR1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX004901 IRAK012E05 pCMV-SPORT6 BC008146 NM_007103 Full/var
HGY089168 IRAL022P08 pOTB7 BC007619 NM_007103 Partial
HGY093354 IRAL033G10 pOTB7 BC015645 NM_007103 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE015202 W01A038A02 pENTR-TOPO IRAL033G10 BC015645 NM_007103
HGE015204 W01A038A04 pENTR-TOPO IRAL033G10 BC015645 NM_007103
HGE015206 W01A038A06 pENTR-TOPO IRAL033G10 BC015645 NM_007103

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR040528 ARe01F08 pKA1U5 NM_007103.3
GGCCAGTTCCTCAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACCCATCTGGCCCG
HKR061756 ARe54G12 pKA1U5 NM_007103.3
GGTCTCTATCGCGCCAGTTCCTCAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACC
HKR184002 ARi60A02 pGCAP10 NM_007103.3
GCCTGCGCGCCACCTAGCGTCTCTATCGCGCCAGTTCCTCAGCCTCAGTGCTATGAAGGT
HKR077629 ARe94B05 pKA1U5 NM_007103.3
TTGAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACCCATCTGGCCCGCCGCGATGC
HKR234060 ARiS085C12 pGCAP10 NM_007103.3
GGCCAGTTCCTCAGCCTCAGTGCTATGAAGGTGACAGCGTGAGGTGACCCATCTGGCCCG
HKR452948 RBdS132G04 pGCAP10 NM_007103.3
GAGCCTAGGATTCCGTGACAGGCCCTCTGGGAAGAACTCCGCGAACAACCCCCTGCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl