Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00402

HP ID(1) HP00402
Gene ID(2) 5687
Gene Symbol finder PSMA6
Protein Name proteasome (prosome, macropain) subunit, alpha type, 6
RefSeq NM_002791.1
Length of RefSeq (bp) 1035
Chromosome 14q13
Reference DDBJ accession
UniGene Hs.446260

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe54D11 pKA1U5 GCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAG
ARe57G12 pKA1U5 GGGAAGCAGTCGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGG
ARf02A12 pKA1U5 GGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTG
ARi56C04 pGCAP10 GGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATT
ARiS008B02 pGCAP10 GGGAAACAGTCGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGG
ARiS150P01 pGCAP10 GGCAACTTCCGGGAGGTNCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTG
ARiS161G20 pGCAP10 GGAGTTCNNNATGCAAGAGCGGAAGAAACGCGGCTGGTACCCCGGAAGCAGTCGCTGCAA
ARiS161P03 pGCAP10 GGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGCGCCGGTTTTGACCGC
RBb15B02 pKA1U5 GAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTTCCCGTGGTTCCAGCGCCGGTT
RBb37C03 pGCAP1 GACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAG
RBb47C08 pGCAP1 ATGAAACTTCCGGGAGGTGCTTGNTGTGCCTGGNTGCGGGAGCTACGGGGCCCAGGGTAT
RBb51D01 pGCAP1 GCCGGGAGGTGCTTGTTGCTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAA
RBb71C10 pGCAP1 TAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGCGCCGGTTT
RBd37F07 pGCAP10 GGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATT
RBd51D03 pGCAP10 GACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAG
RBd55H05 pGCAP10 GGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAGTANNGNTTCTACCAACATGTC
RBd63G01 pGCAP10 GGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl