Prev. |  KEGG KO K02730 > 

RIKEN DNA Bank Human Resource - PSMA6

Gene ID NCBI Gene 5687 |  KEGG hsa:5687
Gene Symbol PSMA6
Protein Name proteasome subunit alpha 6
Synonyms IOTA|PROS27|p27K
Ortholog resources KEGG ortholog (KEGG orthology K02730) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03767 SEREX clone NGO-St-077 (ID 547) #1 SEREX clone NGO-St-077 (ID 547) #1
RDB06714 pET_hsPSMA6 Prokaryotic expression vector of human PSMA6
RDB15486 pLenti6-PSMA6 Rentiviral expression vector of human proteasome subunit alpha 6 (PSMA6), tagged with V5-tag at C-terminal.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083210 IRAL008A10 pOTB7 BC002979 NM_002791 Full
HGY094248 IRAL035K08 pDNR-LIB BC017882 NM_002791 Full
HGY094437 IRAL036B13 pDNR-LIB BC022354 NM_002791 Full
HGY095778 IRAL039H10 pOTB7 BC023659 NM_002791 Full
HGY103038 IRAL057J22 pDNR-LIB BC070137 NM_002791 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004929 W01A012F09 pENTR-TOPO IRAL039H10 BC023659 NM_002791  
HGE004935 W01A012F15 pENTR-TOPO IRAL039H10 BC023659 NM_002791  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061683 ARe54D11 pKA1U5 NM_002791.1  
GCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAG
HKR062956 ARe57G12 pKA1U5 NM_002791.1  
GGGAAGCAGTCGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGG
HKR080812 ARf02A12 pKA1U5 NM_002791.1  
GGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTG
HKR182452 ARi56C04 pGCAP10 NM_002791.1  
GGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATT
HKR203226 ARiS008B02 pGCAP10 NM_002791.1  
GGGAAACAGTCGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGG
HKR260361 ARiS150P01 pGCAP10 NM_002791.1  
GGCAACTTCCGGGAGGTNCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTG
HKR264564 ARiS161G20 pGCAP10 NM_002791.1  
GGAGTTCNNNATGCAAGAGCGGAAGAAACGCGGCTGGTACCCCGGAAGCAGTCGCTGCAA
HKR264763 ARiS161P03 pGCAP10 NM_002791.1  
GGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGCGCCGGTTTTGACCGC
HKR326026 RBb15B02 pKA1U5 NM_002791.1  
GAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTTCCCGTGGTTCCAGCGCCGGTT
HKR334851 RBb37C03 pGCAP1 NM_002791.1  
GACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAG
HKR338856 RBb47C08 pGCAP1 NM_002791.1  
ATGAAACTTCCGGGAGGTGCTTGNTGTGCCTGGNTGCGGGAGCTACGGGGCCCAGGGTAT
HKR340473 RBb51D01 pGCAP1 NM_002791.1  
GCCGGGAGGTGCTTGTTGCTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAA
HKR348458 RBb71C10 pGCAP1 NM_002791.1  
TAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGCGCCGGTTT
HKR374927 RBd37F07 pGCAP10 NM_002791.1  
GGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATT
HKR380475 RBd51D03 pGCAP10 NM_002791.1  
GACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAG
HKR382173 RBd55H05 pGCAP10 NM_002791.1  
GGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAGTANNGNTTCTACCAACATGTC
HKR385345 RBd63G01 pGCAP10 NM_002791.1  
GGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.10.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl