Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00401

HP ID(1) HP00401
Gene ID(2) 7534
Gene Symbol finder YWHAZ
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
RefSeq NM_003406.3
Length of RefSeq (bp) 3003
Chromosome 8q23.1
Reference DDBJ accession
UniGene Hs.492407

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H12 pKA1U5 GGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCCNTTTACGCCCAGAGACTGCTGAGCCC
ARe09D06 pKA1U5 GAGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCC
ARe64C11 pKA1U5 GGAGATCCAGGGNACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGAC
ARe81B07 pKA1U5 GGGAAACCCCGNTGTCTGCGGAGCGGCTGTAGCCTGTGAGCAGCGAGATCCAGGGACAGA
ARe88C11 pKA1U5 GACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGT
ARi18A08 pGCAP10 GGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCG
ARi21A06 pGCAP10 GACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGT
ARi32F05 pGCAP10 GGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCG
ARi40A07 pGCAP10 GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
ARi45F02 pGCAP10 GAGAGACTGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAAAATCCAG
ARiS023P20 pGCAP10 GAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCCGTCCGCCG
ARiS085L08 pGCAP10 GGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCCGTCCGCCGCCACCACCCACT
ARiS150B08 pGCAP10 GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
ARiS198L16 pGCAP10 GCCNTCNANCANNCACCGAGCNCAAATCCCGCCCTCTCNATTGGAACNCCTCCCCNNCAC
RBb18C04 pKA1U5
RBb30B04 pGCAP1 GCCGCTGGGCTCGGGAGGGCGGCTAGCGGCCGCCTCCGGCTCCTTGCTTCCGCATCGACG
RBb71A04 pGCAP1 GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
RBd34C09 pGCAP10 GGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAACATCCAGTCATGGA
RBd42A11 pGCAP10 GACAGTAACCGACGTCTCAAGTCAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAG
RBd60C03 pGCAP10 GGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAACATCCAGTCATGGA
RBd67A03 pGCAP10 GCTCCTTCCCCTTCTTCCGGGCTCCCGTCCCGGCTCATCACCCGGCCTGTGGCCCACTCC
RBd67G11 pGCAP10 GAGCCTGTGAGCAGCGAGATCCAGGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCC
RBd78F10 pGCAP10 GGGGCCGGAGCCCAGGCCTGGCGCGGCGGCGCCCGCCAGAACATCCAGTCATGGATAAAA
RBd94G07 pGCAP10 GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
RBdS015D19 pGCAP10 GACTCCCGTTTCCGAGCCATAAAAGGTCTAGGACCGCTTCCCCCGAGCCAGCAGAACATC
RBdS051I20 pGCAP10 GGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCC
RBdS075K03 pGCAP10 GAGGGAAAGGCCTGGCCGAGAGCGGGCCGGAGCCCAGGCCTGGCGCGGCGGCGCCCGCCA
RBdS105H15 pGCAP10 GAGCCTGTGAGCAGCGAGATCCAGGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCC
RBdS154K02 pGCAP10 GGCGCTCTCGATTGGAACGCCTCCCCATCACTCAGCCACACTCAGGGGCTGGACGCCTCA
RBdS177H12 pGCAP10 TGGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCTA
RBdS177H14 pGCAP10 GACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl