Prev. | Human A to Z list > Y > 

RIKEN DNA Bank Human Resource - YWHAZ

Gene ID (NCBI) 7534
Gene Symbol YWHAZ
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta
Synonyms 14-3-3-zeta|HEL-S-3|HEL4|KCIP-1|YWHAD
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Rb pathway
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16197)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX044106 IRAK110E10 pCMV-SPORT6 BC051814 NM_145690 Full
HGX056426 IRAK141B02 pCMV-SPORT6 BC063824 NM_145690 Full
HGX066772 IRAK166P12 pCMV-SPORT6 BC083508 NM_145690 Full
HGY066828 IRAK167B04 pBluescriptR BC068456 NM_145690 Full/var
HGX069947 IRAK174O11 pCMV-SPORT6 BC072426 NM_145690 Full
HGX069973 IRAK174P13 pCMV-SPORT6 BC073141 NM_145690 Full
HGY081327 IRAL003F07 pOTB7 BC003623 NM_145690 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040580 ARe01H12 pKA1U5 NM_003406.3  
GGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCCNTTTACGCCCAGAGACTGCTGAGCCC
HKR043678 ARe09D06 pKA1U5 NM_003406.3  
GAGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCC
HKR167208 ARi18A08 pGCAP10 NM_003406.3  
GGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCG
HKR168406 ARi21A06 pGCAP10 NM_003406.3  
GACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGT
HKR172925 ARi32F05 pGCAP10 NM_003406.3  
GGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCG
HKR176007 ARi40A07 pGCAP10 NM_003406.3  
GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
HKR178122 ARi45F02 pGCAP10 NM_003406.3  
GAGAGACTGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAAAATCCAG
HKR065659 ARe64C11 pKA1U5 NM_003406.3  
GGAGATCCAGGGNACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGAC
HKR072431 ARe81B07 pKA1U5 NM_003406.3  
GGGAAACCCCGNTGTCTGCGGAGCGGCTGTAGCCTGTGAGCAGCGAGATCCAGGGACAGA
HKR075259 ARe88C11 pKA1U5 NM_003406.3  
GACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGT
HKR209580 ARiS023P20 pGCAP10 NM_003406.3  
GAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCCGTCCGCCG
HKR234272 ARiS085L08 pGCAP10 NM_003406.3  
GGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCCGTCCGCCGCCACCACCCACT
HKR260032 ARiS150B08 pGCAP10 NM_003406.3  
GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
HKR279480 ARiS198L16 pGCAP10 NM_003406.3  
GCCNTCNANCANNCACCGAGCNCAAATCCCGCCCTCTCNATTGGAACNCCTCCCCNNCAC
HKR327252 RBb18C04 pKA1U5 NM_003406.3  
HKR332028 RBb30B04 pGCAP1 NM_003406.3  
GCCGCTGGGCTCGGGAGGGCGGCTAGCGGCCGCCTCCGGCTCCTTGCTTCCGCATCGACG
HKR373657 RBd34C09 pGCAP10 NM_003406.3  
GGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAACATCCAGTCATGGA
HKR376811 RBd42A11 pGCAP10 NM_003406.3  
GACAGTAACCGACGTCTCAAGTCAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAG
HKR384051 RBd60C03 pGCAP10 NM_003406.3  
GGCTGAGCCCGTCCGTCCGCCGCCACCACCCACTCCGGACACAGAACATCCAGTCATGGA
HKR386803 RBd67A03 pGCAP10 NM_003406.3  
GCTCCTTCCCCTTCTTCCGGGCTCCCGTCCCGGCTCATCACCCGGCCTGTGGCCCACTCC
HKR386955 RBd67G11 pGCAP10 NM_003406.3  
GAGCCTGTGAGCAGCGAGATCCAGGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCC
HKR348404 RBb71A04 pGCAP1 NM_003406.3  
GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
HKR391330 RBd78F10 pGCAP10 NM_003406.3  
GGGGCCGGAGCCCAGGCCTGGCGCGGCGGCGCCCGCCAGAACATCCAGTCATGGATAAAA
HKR397751 RBd94G07 pGCAP10 NM_003406.3  
GAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGTCC
HKR406091 RBdS015D19 pGCAP10 NM_003406.3  
GACTCCCGTTTCCGAGCCATAAAAGGTCTAGGACCGCTTCCCCCGAGCCAGCAGAACATC
HKR420612 RBdS051I20 pGCAP10 NM_003406.3  
GGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCC
HKR430243 RBdS075K03 pGCAP10 NM_003406.3  
GAGGGAAAGGCCTGGCCGAGAGCGGGCCGGAGCCCAGGCCTGGCGCGGCGGCGCCCGCCA
HKR442183 RBdS105H15 pGCAP10 NM_003406.3  
GAGCCTGTGAGCAGCGAGATCCAGGGACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCC
HKR461842 RBdS154K02 pGCAP10 NM_003406.3  
GGCGCTCTCGATTGGAACGCCTCCCCATCACTCAGCCACACTCAGGGGCTGGACGCCTCA
HKR470980 RBdS177H12 pGCAP10 NM_003406.3  
TGGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCTA
HKR470982 RBdS177H14 pGCAP10 NM_003406.3  
GACAGAGTCTCAGCCTCGCCGCTGCTGCCGCCGCCGCCGCCCAGAGACTGCTGAGCCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl