Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00394

HP ID(1) HP00394
Gene ID(2) 5701
Gene Symbol finder PSMC2
Protein Name proteasome (prosome, macropain) 26S subunit, ATPase, 2
RefSeq NM_002803.2
Length of RefSeq (bp) 1545
Chromosome 7q22.1-q22.3
Reference DDBJ accession
UniGene Hs.437366

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06A07 pKA1U5 GGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTACCTCG
ARiS013N15 pGCAP10 GTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTACCTCGGTGC
ARiS085F06 pGCAP10 GGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTACCTCGGTGCC
RBd76H10 pGCAP10 GAGGTGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTAC
RBdS081P18 pGCAP10 GAGACACCACCGGAAGCAAGGAAGGTGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGA
RBdS187L03 pGCAP10 GGGAAGCAAGGAAGGTGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl