Prev. |  KEGG KO K03061 > 

RIKEN DNA Bank Human Resource - PSMC2

Gene ID NCBI Gene 5701 |  KEGG hsa:5701
Gene Symbol PSMC2
Protein Name proteasome 26S subunit, ATPase 2
Synonyms MSS1|Nbla10058|S7
Ortholog resources KEGG ortholog (KEGG orthology K03061) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081744 IRAL004F24 pOTB7 BC002589 NM_002803 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042407 ARe06A07 pKA1U5 NM_002803.2  
GGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTACCTCG
HKR205527 ARiS013N15 pGCAP10 NM_002803.2  
GTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTACCTCGGTGC
HKR234126 ARiS085F06 pGCAP10 NM_002803.2  
GGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTACCTCGGTGCC
HKR390578 RBd76H10 pGCAP10 NM_002803.2  
GAGGTGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAATGCCGGATTAC
HKR432778 RBdS081P18 pGCAP10 NM_002803.2  
GAGACACCACCGGAAGCAAGGAAGGTGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGA
HKR475067 RBdS187L03 pGCAP10 NM_002803.2  
GGGAAGCAAGGAAGGTGCTGTGTAATCATTAAGGAGCGGAGGCTTTTGGAGCTGCTAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl