Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00383

HP ID(1) HP00383
Gene ID(2) 10606
Gene Symbol finder PAICS
Protein Name phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase
RefSeq NM_006452.3
Length of RefSeq (bp) 3350
Chromosome 4q12
Reference DDBJ accession
UniGene Hs.518774

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe57D05 pKA1U5 GGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCNCTTAGGATAATGGCGACAGCTGA
ARi70H10 pGCAP10 GCTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAAT
ARiS096K24 pGCAP10 GCTCTGACCACCCCTCTTTTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTC
RBb19E06 pKA1U5 ATCCTGTGTGTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTT
RBb57D04 pGCAP1 GGCTTCCCGGCGCGGGTCGCAGCCCTCAGCCCACTTTAGGATAATGGCGACAGCTGAGGT
RBd05D04 pGCAP10 GAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATGGCG
RBd15E12 pGCAP10 GCTCAGCCCACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGGTAAAAAATTATA
RBd17G09 pGCAP10 GTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATG
RBd47C06 pGCAP10 GAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATGGCG
RBd59H01 pGCAP10 GACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGGTAAAAAATTATATGAGGGTA
RBd87A10 pGCAP10 TGGGAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATG
RBdS070P01 pGCAP10 GGCAGCCCTCAGCCCACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGGTAAAAA
RBdS105N19 pGCAP10 GGCGGTCGCAGCCCTCAGCCCACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl