Prev. |  KEGG KO K01587 > 

RIKEN DNA Bank Human Resource - PAICS

Gene ID NCBI Gene 10606 |  KEGG hsa:10606
Gene Symbol PAICS
Protein Name phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase
Synonyms ADE2|ADE2H1|AIRC|PAIS
Ortholog resources KEGG ortholog (KEGG orthology K01587) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001457 IRAK003K17 pCMV-SPORT6 BC010273 NM_006452 Full
HGY083451 IRAL008K11 pOTB7 BC019255 NM_006452 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097623 M01C044A23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097671 M01C044C23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097719 M01C044E23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097767 M01C044G23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097815 M01C044I23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097863 M01C044K23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097911 M01C044M23 pDONR221 MGC11-E12 BC019255 NM_006452  
HGE097959 M01C044O23 pDONR221 MGC11-E12 BC019255 NM_006452  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062877 ARe57D05 pKA1U5 NM_006452.3  
GGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCNCTTAGGATAATGGCGACAGCTGA
HKR188178 ARi70H10 pGCAP10 NM_006452.3  
GCTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAAT
HKR238664 ARiS096K24 pGCAP10 NM_006452.3  
GCTCTGACCACCCCTCTTTTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTC
HKR327702 RBb19E06 pKA1U5 NM_006452.3  
ATCCTGTGTGTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTT
HKR342876 RBb57D04 pGCAP1 NM_006452.3  
GGCTTCCCGGCGCGGGTCGCAGCCCTCAGCCCACTTTAGGATAATGGCGACAGCTGAGGT
HKR362076 RBd05D04 pGCAP10 NM_006452.3  
GAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATGGCG
HKR366108 RBd15E12 pGCAP10 NM_006452.3  
GCTCAGCCCACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGGTAAAAAATTATA
HKR366953 RBd17G09 pGCAP10 NM_006452.3  
GTCTAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATG
HKR378854 RBd47C06 pGCAP10 NM_006452.3  
GAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATGGCG
HKR383769 RBd59H01 pGCAP10 NM_006452.3  
GACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGGTAAAAAATTATATGAGGGTA
HKR394810 RBd87A10 pGCAP10 NM_006452.3  
TGGGAGAGTTCTGCCTCGCTTCCCGGCGCGGTCGCAGCCCTCAGCCCACTTAGGATAATG
HKR428361 RBdS070P01 pGCAP10 NM_006452.3  
GGCAGCCCTCAGCCCACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGGTAAAAA
HKR442331 RBdS105N19 pGCAP10 NM_006452.3  
GGCGGTCGCAGCCCTCAGCCCACTTAGGATAATGGCGACAGCTGAGGTACTGAACATTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl