Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00382

HP ID(1) HP00382
Gene ID(2) 4673
Gene Symbol finder NAP1L1
Protein Name nucleosome assembly protein 1-like 1
RefSeq NM_139207.1
Length of RefSeq (bp) 3582
Chromosome 12q21.2
Reference DDBJ accession
UniGene Hs.524599

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02F08 pKA1U5 GGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCG
ARe09E06 pKA1U5 GCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCC
ARe33H03 pKA1U5 GGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGC
ARe41G03 pKA1U5 GCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCT
ARe46C12 pKA1U5 GCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTG
ARi11E11 pGCAP10 GCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
ARiS085C07 pGCAP10 TCCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCG
ARiS087C18 pGCAP10 GCCCCCGGCGGCTTCNCTCCACACGTGGTAATGGGCTTCATGGCCACTGGCTGGGCCTGG
ARiS096C04 pGCAP10 CTTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
ARiS109M01 pGCAP10 TTTTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCG
ARiS118D04 pGCAP10 GCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGG
RBb49E01 pGCAP1 GCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGNTCACTGCCCGCNTNAGCTCCGGCCGCC
RBd04A12 pGCAP10 GGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGG
RBd16H03 pGCAP10 GCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGC
RBd21D05 pGCAP10 GAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCC
RBd33A05 pGCAP10 GACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGAGTTC
RBd47F09 pGCAP10 GCCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGG
RBd84C03 pGCAP10 GCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
RBd91A05 pGCAP10 GGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGGTGCT
RBdS075E10 pGCAP10 GAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGA
RBdS104G16 pGCAP10 GCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
RBdS105J02 pGCAP10 GCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTG
RBdS177D07 pGCAP10 GGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl