Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAP1L1

Gene ID (NCBI) 4673
Gene Symbol NAP1L1
Protein Name nucleosome assembly protein 1-like 1
Synonyms NAP1|NAP1L|NRP
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11279)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080767 IRAL001P07 pOTB7 BC002387 NM_139207 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017616 W01A044A16 pENTR-TOPO IRAL001P07 BC002387 NM_139207  
HGE017620 W01A044A20 pENTR-TOPO IRAL001P07 BC002387 NM_139207  
HGE017622 W01A044A22 pENTR-TOPO IRAL001P07 BC002387 NM_139207  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040928 ARe02F08 pKA1U5 NM_139207.1  
GGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCG
HKR043702 ARe09E06 pKA1U5 NM_139207.1  
GCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCC
HKR164507 ARi11E11 pGCAP10 NM_139207.1  
GCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
HKR053371 ARe33H03 pKA1U5 NM_139207.1  
GGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGC
HKR056547 ARe41G03 pKA1U5 NM_139207.1  
GCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCT
HKR058460 ARe46C12 pKA1U5 NM_139207.1  
GCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTG
HKR234055 ARiS085C07 pGCAP10 NM_139207.1  
TCCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCG
HKR234866 ARiS087C18 pGCAP10 NM_139207.1  
GCCCCCGGCGGCTTCNCTCCACACGTGGTAATGGGCTTCATGGCCACTGGCTGGGCCTGG
HKR238452 ARiS096C04 pGCAP10 NM_139207.1  
CTTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
HKR243889 ARiS109M01 pGCAP10 NM_139207.1  
TTTTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCG
HKR247276 ARiS118D04 pGCAP10 NM_139207.1  
GCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGG
HKR361612 RBd04A12 pGCAP10 NM_139207.1  
GGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGG
HKR366571 RBd16H03 pGCAP10 NM_139207.1  
GCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGC
HKR368477 RBd21D05 pGCAP10 NM_139207.1  
GAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCC
HKR373205 RBd33A05 pGCAP10 NM_139207.1  
GACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGAGTTC
HKR339697 RBb49E01 pGCAP1 NM_139207.1  
GCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGNTCACTGCCCGCNTNAGCTCCGGCCGCC
HKR378929 RBd47F09 pGCAP10 NM_139207.1  
GCCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGG
HKR393651 RBd84C03 pGCAP10 NM_139207.1  
GCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
HKR396405 RBd91A05 pGCAP10 NM_139207.1  
GGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGGTGCT
HKR430106 RBdS075E10 pGCAP10 NM_139207.1  
GAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGA
HKR441760 RBdS104G16 pGCAP10 NM_139207.1  
GCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGC
HKR442218 RBdS105J02 pGCAP10 NM_139207.1  
GCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTG
HKR470879 RBdS177D07 pGCAP10 NM_139207.1  
GGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl