Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00376

HP ID(1) HP00376
Gene ID(2) 91408
Gene Symbol finder BTF3L4
Protein Name basic transcription factor 3-like 4
RefSeq NM_152265.3
Length of RefSeq (bp) 2345
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.538093

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe30B08 pKA1U5 GGAGGCAGCCATCTTTCTCTTGCCGCGTGCTGGTGTTGGAGGACCCTCCCTGCTTCAGAT
ARiS109M07 pGCAP10 GGTCGTCTTTCTCTGTCTCGGCTGAGGCAGCCATCTTTCTCTTGCCGCGTGCTGGTGTTG
RBb25G12 pGCAP1 GATCTGCTCCCGCCGCCGCCGCCGCCGCCGTCGTCTTTCTCTGTCTCGGCTGAGGCAGCC
RBd79D04 pGCAP10 CTTTTCTCTTGCCGCGTGCTGGTGTTGGAGGACCCTCCCTGCTTCAGATTTACCAACAGC
RBdS007C02 pGCAP10 GGTCTCGGCTGAGGCAGCCATCTTTCTCTTGCCGCGTGCTGGTGTTGGAGGACCCTCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl