Prev. |  KEGG KO K01527 > 

RIKEN DNA Bank Human Resource - BTF3L4

Gene ID NCBI Gene 91408 |  KEGG hsa:91408
Gene Symbol BTF3L4
Protein Name basic transcription factor 3 like 4
Synonyms -
Ortholog resource in our bank

  BTF3L4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085663 IRAL014C15 pOTB7 BC021004 NM_152265 Partial/var
HGY095022 IRAL037J06 pDNR-LIB BC022371 NM_152265 Full
HGY103030 IRAL057J14 pDNR-LIB BC070378 NM_152265 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096820 M01C042A20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE096868 M01C042C20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE096916 M01C042E20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE096964 M01C042G20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE097012 M01C042I20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE097060 M01C042K20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE097108 M01C042M20 pDONR221 MGC10-F10 BC022371 NM_152265  
HGE097156 M01C042O20 pDONR221 MGC10-F10 BC022371 NM_152265  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052032 ARe30B08 pKA1U5 NM_152265.3  
GGAGGCAGCCATCTTTCTCTTGCCGCGTGCTGGTGTTGGAGGACCCTCCCTGCTTCAGAT
HKR243895 ARiS109M07 pGCAP10 NM_152265.3  
GGTCGTCTTTCTCTGTCTCGGCTGAGGCAGCCATCTTTCTCTTGCCGCGTGCTGGTGTTG
HKR330156 RBb25G12 pGCAP1 NM_152265.3  
GATCTGCTCCCGCCGCCGCCGCCGCCGCCGTCGTCTTTCTCTGTCTCGGCTGAGGCAGCC
HKR391676 RBd79D04 pGCAP10 NM_152265.3  
CTTTTCTCTTGCCGCGTGCTGGTGTTGGAGGACCCTCCCTGCTTCAGATTTACCAACAGC
HKR402850 RBdS007C02 pGCAP10 NM_152265.3  
GGTCTCGGCTGAGGCAGCCATCTTTCTCTTGCCGCGTGCTGGTGTTGGAGGACCCTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl