Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00366

HP ID(1) HP00366
Gene ID(2) 7311
Gene Symbol finder UBA52
Protein Name ubiquitin A-52 residue ribosomal protein fusion product 1
RefSeq NM_003333.3
Length of RefSeq (bp) 2801
Chromosome 19p13.1-p12
Reference DDBJ accession
UniGene Hs.5308

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26H12 pKA1U5 TTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCC
ARe35D08 pKA1U5 GAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTT
ARe75F05 pKA1U5 CTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCACACNTGCAGATCTTTGTGAAGACCCTC
ARe75F06 pKA1U5 CTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCACANTTGNAGATCTTTGTGAAGACCCTC
ARi28A01 pGCAP10 GTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACC
ARi33F08 pGCAP10 TTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCC
ARi34C01 pGCAP10 TTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCC
ARi40F02 pGCAP10 GTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTC
ARi45A04 pGCAP10 GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
ARi46D10 pGCAP10 GCTTCTTTTTCTTCGGCGAGGCGGCCGAGCTGACGCAAACATGCTNATCTTTGTGAAGAC
ARi65B02 pGCAP10 GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCANCATGCAGATCTTTGTGANACCC
ARi71B06 pGCAP10 GAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCACTGGCAAA
ARiS008O23 pGCAP10 GAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTT
ARiS122C24 pGCAP10 GGTTTTTCCGGTTCCGCTATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACA
ARiS150I11 pGCAP10 GCTTTTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
ARiS194P15 pGCAP10 GTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAA
RBb12C09 pKA1U5 TTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCA
RBb44H06 pGCAP1 GGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTTTGTGAA
RBb46A03 pGCAP1 GCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTTTG
RBb56H02 pGCAP1 TTGTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGC
RBb65H11 pGCAP1 GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
RBd06F06 pGCAP10 GCTTTTTTTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACA
RBd07E02 pGCAP10 GCTTTTTTTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACA
RBd20F03 pGCAP10 GGTTCCGCTATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGT
RBd33E01 pGCAP10 GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAA
RBd43B09 pGCAP10 ATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGA
RBd91H10 pGCAP10 GTCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGA
RBd99C02 pGCAP10 GAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTT
RBdS013A18 pGCAP10 GCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCT
RBdS022J01 pGCAP10 TATGCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
RBdS040C09 pGCAP10 GAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCACTGGCAAA
RBdS040P13 pGCAP10 GTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTTTGTGAAGACCCTCACT
RBdS051B11 pGCAP10 GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
RBdS083M06 pGCAP10 GCTTTTTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGA
RBdS132L03 pGCAP10 GCTTTTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl