Prev. |  KEGG KO K02927 > 

RIKEN DNA Bank Human Resource - UBA52

Gene ID NCBI Gene 7311 |  KEGG hsa:7311
Gene Symbol UBA52
Protein Name ubiquitin A-52 residue ribosomal protein fusion product 1
Synonyms CEP52|HUBCEP52|L40|RPL40
Ortholog resources KEGG ortholog (KEGG orthology K02927) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050580 ARe26H12 pKA1U5 NM_003333.3  
TTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCC
HKR054080 ARe35D08 pKA1U5 NM_003333.3  
GAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTT
HKR070125 ARe75F05 pKA1U5 NM_003333.3  
CTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCACACNTGCAGATCTTTGTGAAGACCCTC
HKR070126 ARe75F06 pKA1U5 NM_003333.3  
CTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCACANTTGNAGATCTTTGTGAAGACCCTC
HKR171201 ARi28A01 pGCAP10 NM_003333.3  
GTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACC
HKR173328 ARi33F08 pGCAP10 NM_003333.3  
TTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCC
HKR173649 ARi34C01 pGCAP10 NM_003333.3  
TTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCC
HKR176122 ARi40F02 pGCAP10 NM_003333.3  
GTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTC
HKR178004 ARi45A04 pGCAP10 NM_003333.3  
GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
HKR178482 ARi46D10 pGCAP10 NM_003333.3  
GCTTCTTTTTCTTCGGCGAGGCGGCCGAGCTGACGCAAACATGCTNATCTTTGTGAAGAC
HKR186026 ARi65B02 pGCAP10 NM_003333.3  
GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCANCATGCAGATCTTTGTGANACCC
HKR188430 ARi71B06 pGCAP10 NM_003333.3  
GAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCACTGGCAAA
HKR203559 ARiS008O23 pGCAP10 NM_003333.3  
GAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTT
HKR248872 ARiS122C24 pGCAP10 NM_003333.3  
GGTTTTTCCGGTTCCGCTATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACA
HKR260203 ARiS150I11 pGCAP10 NM_003333.3  
GCTTTTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
HKR277975 ARiS194P15 pGCAP10 NM_003333.3  
GTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAA
HKR324857 RBb12C09 pKA1U5 NM_003333.3  
TTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCA
HKR337774 RBb44H06 pGCAP1 NM_003333.3  
GGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTTTGTGAA
HKR338403 RBb46A03 pGCAP1 NM_003333.3  
GCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTTTG
HKR342570 RBb56H02 pGCAP1 NM_003333.3  
TTGTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGC
HKR346179 RBb65H11 pGCAP1 NM_003333.3  
GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
HKR362526 RBd06F06 pGCAP10 NM_003333.3  
GCTTTTTTTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACA
HKR362898 RBd07E02 pGCAP10 NM_003333.3  
GCTTTTTTTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACA
HKR368123 RBd20F03 pGCAP10 NM_003333.3  
GGTTCCGCTATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGT
HKR373297 RBd33E01 pGCAP10 NM_003333.3  
GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAA
HKR377233 RBd43B09 pGCAP10 NM_003333.3  
ATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGA
HKR396578 RBd91H10 pGCAP10 NM_003333.3  
GTCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGA
HKR399650 RBd99C02 pGCAP10 NM_003333.3  
GAGCGAGGCGGCCGAGCTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTT
HKR405218 RBdS013A18 pGCAP10 NM_003333.3  
GCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCT
HKR409017 RBdS022J01 pGCAP10 NM_003333.3  
TATGCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
HKR416057 RBdS040C09 pGCAP10 NM_003333.3  
GAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCACTGGCAAA
HKR416373 RBdS040P13 pGCAP10 NM_003333.3  
GTGGTTGGTGGCGGCGGTCGTGCGGACGCAAACATGCAGATCTTTGTGAAGACCCTCACT
HKR420435 RBdS051B11 pGCAP10 NM_003333.3  
GCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC
HKR433494 RBdS083M06 pGCAP10 NM_003333.3  
GCTTTTTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGA
HKR453067 RBdS132L03 pGCAP10 NM_003333.3  
GCTTTTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl