Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00358

HP ID(1) HP00358
Gene ID(2) 26986
Gene Symbol finder PABPC1
Protein Name poly(A) binding protein, cytoplasmic 1
RefSeq NM_002568.3
Length of RefSeq (bp) 2869
Chromosome 8q22.2-q23
Reference DDBJ accession
UniGene Hs.387804

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02G08 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe07H12 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARe10G06 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARe13H07 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARe15H05 pKA1U5 ATCCTGGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCG
ARe18G03 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe19B04 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGATGTGTGCTCCGGGCTCGGAAC
ARe25F04 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe26C10 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe30G03 pKA1U5 GCCCTTCTCCCCGGCGGNTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe32A04 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe36H03 pKA1U5 GCCCCTTCTCCCCGGCGGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAAC
ARe36H12 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe37B02 pKA1U5 ATCCTGGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCG
ARe38B10 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARe43G10 pKA1U5 GGGCGGTGCTTCCCCTTCTCCCCGGCGGATTAGCNCTTNNAGGGCGGAGTGTGTGCTCCG
ARe47C07 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe52D07 pKA1U5 GCCTTCTCCCCGGCGGTTTAGTGCTGAGAGTGCGNAGTGTGTGCTCCGGGCTCGGAACAC
ARe57B08 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCNGATTGTGTGCTCCGGGCTCGGAACACA
ARe57F09 pKA1U5 ATCCTGNTTGCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGG
ARe59E06 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe60H01 pKA1U5 GCCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAAC
ARe63A12 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARe64A02 pKA1U5 GACATCTGCACCNCGCACGTCCCAGCGTAGATNCCAGCAGGAGNGCAGNTGGTNAGCGTG
ARe68F08 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe68H01 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe70A08 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARe78C07 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe78D07 pKA1U5 GCCCCGTTCTCCCCNGCGGCTTAGTGCTGAGTAGTGCAGGAGTGTGTGCTCCGGGCTCGG
ARe82C06 pKA1U5 AGGGCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGA
ARe88E09 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARe97B11 pKA1U5 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARe97C08 pKA1U5 GCCTTCTCCCCGGCGGCTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARf03G04 pKA1U5 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARi09A04 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARi09G07 pGCAP10 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARi10F09 pGCAP10 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARi14H06 pGCAP10 TTGATGTTATAAAGGGCAAGCCAGTACGCATCATGTGGTCTCAGCGTGATCCATCACTTC
ARi24H01 pGCAP10 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARi36B11 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
ARi42A12 pGCAP10 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARi45G11 pGCAP10 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARi50F04 pGCAP10 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARi59H12 pGCAP10 GCCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAAC
ARi62D10 pGCAP10 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGNGTGCTCCGGGCTCGNANAC
ARi66D07 pGCAP10 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARiS088M19 pGCAP10 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
ARiS122C14 pGCAP10 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
ARiS194A19 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBb03A09 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBb04C08 pKA1U5 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBb34B02 pGCAP1 GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGCTGCTCCGGGCTCGGAACAC
RBb57C02 pGCAP1 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
RBd01D12 pGCAP10 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
RBd15B03 pGCAP10 GCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACAC
RBd77C07 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBd84B04 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBd87B11 pGCAP10 AGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
RBd96C07 pGCAP10 AGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
RBd98F12 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS007B11 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS007O02 pGCAP10 GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
RBdS013F16 pGCAP10 GCCCTTCTCCCCGGCNGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS014K09 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS015O08 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS051M16 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS104N04 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
RBdS105M12 pGCAP10 GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl