Prev. |  KEGG KO K13126 > 

RIKEN DNA Bank Human Resource - PABPC1

Gene ID NCBI Gene 26986 |  KEGG hsa:26986
Gene Symbol PABPC1
Protein Name poly(A) binding protein cytoplasmic 1
Synonyms PAB1|PABP|PABP1|PABPC2|PABPL1
Ortholog resources KEGG ortholog (KEGG orthology K13126) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13281 pUC-T7-HCV-PABP-HA HCV IRES-dependent expression vector of human PABP
RDB13285 pUC-T7-HCV-HA-PABP HCV IRES-dependent expression vector of human PABP

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029935 IRAK074N23 pBluescriptR BC041863 NM_002568 Full
HGY086924 IRAL017F04 pOTB7 BC023520 NM_002568 Full
HGY090118 IRAL025E22 pOTB7 BC015958 NM_002568 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018069 W01A045C21 pENTR-TOPO flj0046j12 AK095194 NM_002568  
HGE018071 W01A045C23 pENTR-TOPO flj0046j12 AK095194 NM_002568  
HGE018097 W01A045E01 pENTR-TOPO flj0046j12 AK095194 NM_002568  
HGE018099 W01A045E03 pENTR-TOPO flj0046j12 AK095194 NM_002568  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040952 ARe02G08 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR042980 ARe07H12 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR044150 ARe10G06 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR045375 ARe13H07 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR046173 ARe15H05 pKA1U5 NM_002568.3  
ATCCTGGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCG
HKR047347 ARe18G03 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR047628 ARe19B04 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGATGTGTGCTCCGGGCTCGGAAC
HKR050124 ARe25F04 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR050458 ARe26C10 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR052147 ARe30G03 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGNTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR052804 ARe32A04 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR054571 ARe36H03 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAAC
HKR054580 ARe36H12 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR054826 ARe37B02 pKA1U5 NM_002568.3  
ATCCTGGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCG
HKR055234 ARe38B10 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR057354 ARe43G10 pKA1U5 NM_002568.3  
GGGCGGTGCTTCCCCTTCTCCCCGGCGGATTAGCNCTTNNAGGGCGGAGTGTGTGCTCCG
HKR058855 ARe47C07 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR060879 ARe52D07 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTTAGTGCTGAGAGTGCGNAGTGTGTGCTCCGGGCTCGGAACAC
HKR062832 ARe57B08 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCNGATTGTGTGCTCCGGGCTCGGAACACA
HKR062929 ARe57F09 pKA1U5 NM_002568.3  
ATCCTGNTTGCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGG
HKR063702 ARe59E06 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR064169 ARe60H01 pKA1U5 NM_002568.3  
GCCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAAC
HKR065212 ARe63A12 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR065602 ARe64A02 pKA1U5 NM_002568.3  
GACATCTGCACCNCGCACGTCCCAGCGTAGATNCCAGCAGGAGNGCAGNTGGTNAGCGTG
HKR067328 ARe68F08 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR067369 ARe68H01 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR068008 ARe70A08 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR071255 ARe78C07 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR071279 ARe78D07 pKA1U5 NM_002568.3  
GCCCCGTTCTCCCCNGCGGCTTAGTGCTGAGTAGTGCAGGAGTGTGTGCTCCGGGCTCGG
HKR072854 ARe82C06 pKA1U5 NM_002568.3  
AGGGCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGA
HKR075305 ARe88E09 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR078835 ARe97B11 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR078856 ARe97C08 pKA1U5 NM_002568.3  
GCCTTCTCCCCGGCGGCTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR081348 ARf03G04 pKA1U5 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR163604 ARi09A04 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR163751 ARi09G07 pGCAP10 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR164129 ARi10F09 pGCAP10 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR165774 ARi14H06 pGCAP10 NM_002568.3  
TTGATGTTATAAAGGGCAAGCCAGTACGCATCATGTGGTCTCAGCGTGATCCATCACTTC
HKR169769 ARi24H01 pGCAP10 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR174435 ARi36B11 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR176812 ARi42A12 pGCAP10 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR178155 ARi45G11 pGCAP10 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR180124 ARi50F04 pGCAP10 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR183780 ARi59H12 pGCAP10 NM_002568.3  
GCCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAAC
HKR184882 ARi62D10 pGCAP10 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGNGTGCTCCGGGCTCGNANAC
HKR186479 ARi66D07 pGCAP10 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR235507 ARiS088M19 pGCAP10 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR248862 ARiS122C14 pGCAP10 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACA
HKR277619 ARiS194A19 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR321209 RBb03A09 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR321656 RBb04C08 pKA1U5 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR333626 RBb34B02 pGCAP1 NM_002568.3  
GCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGCTGCTCCGGGCTCGGAACAC
HKR342850 RBb57C02 pGCAP1 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR360484 RBd01D12 pGCAP10 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR366027 RBd15B03 pGCAP10 NM_002568.3  
GCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACAC
HKR390855 RBd77C07 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR393628 RBd84B04 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR394835 RBd87B11 pGCAP10 NM_002568.3  
AGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR398455 RBd96C07 pGCAP10 NM_002568.3  
AGCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR399332 RBd98F12 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR402835 RBdS007B11 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR403138 RBdS007O02 pGCAP10 NM_002568.3  
GCCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACA
HKR405336 RBdS013F16 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCNGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR405849 RBdS014K09 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR406344 RBdS015O08 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR420704 RBdS051M16 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR441916 RBdS104N04 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC
HKR442300 RBdS105M12 pGCAP10 NM_002568.3  
GCCCTTCTCCCCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl