Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00346

HP ID(1) HP00346
Gene ID(2) 4738
Gene Symbol finder NEDD8
Protein Name neural precursor cell expressed, developmentally down-regulated 8
RefSeq NM_006156.2
Length of RefSeq (bp) 625
Chromosome 14q12
Reference DDBJ accession
UniGene Hs.531064

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01G11 pKA1U5 GGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGA
ARe31G12 pKA1U5 GGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCA
ARe81E02 pKA1U5 GGTAGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTA
ARiS161M17 pGCAP10 GAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGTGCAGCCCCAAACTGGAAAG
ARiS191M19 pGCAP10 GAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGT
RBb27F01 pGCAP1 GCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAAT
RBd09E07 pGCAP10 GAGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGG
RBd13D04 pGCAP10 GAGTGACCCGGAAGTAGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCG
RBd44A01 pGCAP10 GAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGT
RBd54D10 pGCAP10 GAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCNNCAATTTATCCGTGT
RBdS040I21 pGCAP10 GAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGTGCAGCCCCAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl