Prev. |  KEGG KO K12158 > 

RIKEN DNA Bank Human Resource - NEDD8

Gene ID NCBI Gene 4738 |  KEGG hsa:4738
Gene Symbol NEDD8
Protein Name NEDD8 ubiquitin like modifier
Synonyms NEDD-8
Ortholog resource in our bank

  NEDD8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033114 IRAK082N02 pCMV-SPORT6 BC038290 NM_006156 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040555 ARe01G11 pKA1U5 NM_006156.2  
GGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGA
HKR052556 ARe31G12 pKA1U5 NM_006156.2  
GGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCA
HKR072498 ARe81E02 pKA1U5 NM_006156.2  
GGTAGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTA
HKR264705 ARiS161M17 pGCAP10 NM_006156.2  
GAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGTGCAGCCCCAAACTGGAAAG
HKR276707 ARiS191M19 pGCAP10 NM_006156.2  
GAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGT
HKR330921 RBb27F01 pGCAP1 NM_006156.2  
GCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAAT
HKR363703 RBd09E07 pGCAP10 NM_006156.2  
GAGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGG
HKR365276 RBd13D04 pGCAP10 NM_006156.2  
GAGTGACCCGGAAGTAGAAGTGGCCCTTGCAGGCAAGAGTGCTGGAGGGCGGCAGCGGCG
HKR377601 RBd44A01 pGCAP10 NM_006156.2  
GAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGT
HKR381682 RBd54D10 pGCAP10 NM_006156.2  
GAAGAGTGCTGGAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCNNCAATTTATCCGTGT
HKR416213 RBdS040I21 pGCAP10 NM_006156.2  
GAGGGCGGCAGCGGCGACCGGAGCGGTAGGAGCAGCAATTTATCCGTGTGCAGCCCCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl