Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00334

HP ID(1) HP00334
Gene ID(2) 5695
Gene Symbol finder PSMB7
Protein Name proteasome (prosome, macropain) subunit, beta type, 7
RefSeq NM_002799.2
Length of RefSeq (bp) 1012
Chromosome 9q34.11-q34.12
Reference DDBJ accession
UniGene Hs.213470

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H01 pKA1U5 ATCCTGGACCGTTTATCTCCGTCTCCTAAGGCACTTTNACGGCCCCTTTGAATGCCGTCT
ARi46A03 pGCAP10 ACCTTTTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTC
ARi49G02 pGCAP10 GCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCTTTTGA
ARi60A04 pGCAP10 GCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCTTTTGA
ARiS008D22 pGCAP10 GGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCT
RBb02D02 pKA1U5 GAGAGTGGAATTCTGGGTGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCA
RBd82C11 pGCAP10 GGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCT
RBd95B07 pGCAP10 GGGAACTGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGC
RBdS013O23 pGCAP10 GGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl