Prev. |  KEGG KO K02739 > 

RIKEN DNA Bank Human Resource - PSMB7

Gene ID NCBI Gene 5695 |  KEGG hsa:5695
Gene Symbol PSMB7
Protein Name proteasome subunit beta 7
Synonyms Z
Ortholog resources KEGG ortholog (KEGG orthology K02739) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006225 IRAK015J09 pCMV-SPORT6 BC017116 NM_002799 Partial/var
HGY080586 IRAL001H18 pOTB7 BC000509 NM_002799 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005394 W01A013I02 pENTR-TOPO IRAL001H18 BC000509 NM_002799  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040569 ARe01H01 pKA1U5 NM_002799.2  
ATCCTGGACCGTTTATCTCCGTCTCCTAAGGCACTTTNACGGCCCCTTTGAATGCCGTCT
HKR178403 ARi46A03 pGCAP10 NM_002799.2  
ACCTTTTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTC
HKR179746 ARi49G02 pGCAP10 NM_002799.2  
GCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCTTTTGA
HKR184004 ARi60A04 pGCAP10 NM_002799.2  
GCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCTTTTGA
HKR203294 ARiS008D22 pGCAP10 NM_002799.2  
GGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCT
HKR320874 RBb02D02 pKA1U5 NM_002799.2  
GAGAGTGGAATTCTGGGTGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCA
HKR392859 RBd82C11 pGCAP10 NM_002799.2  
GGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCT
HKR398031 RBd95B07 pGCAP10 NM_002799.2  
GGGAACTGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGC
HKR405559 RBdS013O23 pGCAP10 NM_002799.2  
GGCTTTCTTGGGAAGATGGCGGCTGTGTCGGTGTATGCTCCACCAGTTGGAGGCTTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl