Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00330

HP ID(1) HP00330
Gene ID(2) 4715
Gene Symbol finder NDUFB9
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
RefSeq NM_005005.2
Length of RefSeq (bp) 736
Chromosome 8q13.3
Reference DDBJ accession
UniGene Hs.15977

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe41A03 pKA1U5 GAGCGCCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTT
ARe55B11 pKA1U5 GGCGCGGCCGGGGTAANGTCAGCGCCGTAATGGCNTTNTTGGCGTCGGGACCCTACCTGA
ARi19A03 pGCAP10 GCCGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATGGCGTTCTTGGCGTCGGGAC
RBb68C05 pGCAP1 TGGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATGGCGTTCTTGGCGTCGGGACC
RBd04B05 pGCAP10 GCCCCGCTCGGTCACCCGCAGCAGGCGTGCAGTTTCCCGGCTCTCCGCGCGGCCGGGGAA
RBd95E04 pGCAP10 GGCAGCAGGCGTGCAGTTTCCCGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATG
RBdS110K06 pGCAP10 GAGCGCCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl