Prev. |  KEGG KO K03965 > 

RIKEN DNA Bank Human Resource - NDUFB9

Gene ID NCBI Gene 4715 |  KEGG hsa:4715
Gene Symbol NDUFB9
Protein Name NADH:ubiquinone oxidoreductase subunit B9
Synonyms B22|CI-B22|LYRM3|UQOR22
Ortholog resources KEGG ortholog (KEGG orthology K03965) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081736 IRAL004F16 pOTB7 BC007672 NM_005005 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056403 ARe41A03 pKA1U5 NM_005005.2  
GAGCGCCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTT
HKR062035 ARe55B11 pKA1U5 NM_005005.2  
GGCGCGGCCGGGGTAANGTCAGCGCCGTAATGGCNTTNTTGGCGTCGGGACCCTACCTGA
HKR167603 ARi19A03 pGCAP10 NM_005005.2  
GCCGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATGGCGTTCTTGGCGTCGGGAC
HKR347253 RBb68C05 pGCAP1 NM_005005.2  
TGGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATGGCGTTCTTGGCGTCGGGACC
HKR361629 RBd04B05 pGCAP10 NM_005005.2  
GCCCCGCTCGGTCACCCGCAGCAGGCGTGCAGTTTCCCGGCTCTCCGCGCGGCCGGGGAA
HKR398100 RBd95E04 pGCAP10 NM_005005.2  
GGCAGCAGGCGTGCAGTTTCCCGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATG
HKR444246 RBdS110K06 pGCAP10 NM_005005.2  
GAGCGCCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl