Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00286

HP ID(1) HP00286
Gene ID(2) 2923
Gene Symbol finder PDIA3
Protein Name protein disulfide isomerase family A, member 3
RefSeq NM_005313.4
Length of RefSeq (bp) 3060
Chromosome 15q15
Reference DDBJ accession
UniGene Hs.591095

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe29D12 pKA1U5 GACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCG
ARe69F10 pKA1U5 GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGNGCGCCCGACCTCCGCAGTCCCAGC
ARe88C01 pKA1U5 TGAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAG
ARi16B11 pGCAP10 GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
ARiS045P07 pGCAP10 GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
RBb65C11 pGCAP1
RBb67A09 pGCAP1 AGAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAG
RBd39G03 pGCAP10 GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
RBd58C10 pGCAP10 GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
RBd76G10 pGCAP10 GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
RBdS104H23 pGCAP10 GACACAGCGGCCCAAGCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGC
RBdS132G22 pGCAP10 TGGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl