Prev. |  KEGG KO K08056 > 

RIKEN DNA Bank Human Resource - PDIA3

Gene ID NCBI Gene 2923 |  KEGG hsa:2923
Gene Symbol PDIA3
Protein Name protein disulfide isomerase family A member 3
Synonyms ER60|ERp57|ERp60|ERp61|GRP57|GRP58|HEL-S-269|HEL-S-93n|HsT17083|P58|PI-PLC
Ortholog resources KEGG ortholog (KEGG orthology K08056) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096653 IRAL041K13 pDNR-LIB BC036000 -
HGY083494 IRAL008M06 pOTB7 BC014433 -
HGY103499 IRAL058M11 pOTB7 BC071878 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007372 W01A018H04 pENTR-TOPO IRAL008M06 BC014433 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051684 ARe29D12 pKA1U5 NM_005313.4  
GACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCG
HKR067730 ARe69F10 pKA1U5 NM_005313.4  
GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGNGCGCCCGACCTCCGCAGTCCCAGC
HKR075249 ARe88C01 pKA1U5 NM_005313.4  
TGAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAG
HKR166435 ARi16B11 pGCAP10 NM_005313.4  
GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
HKR218367 ARiS045P07 pGCAP10 NM_005313.4  
GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
HKR346059 RBb65C11 pGCAP1 NM_005313.4  
HKR346809 RBb67A09 pGCAP1 NM_005313.4  
AGAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAG
HKR375747 RBd39G03 pGCAP10 NM_005313.4  
GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
HKR383258 RBd58C10 pGCAP10 NM_005313.4  
GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
HKR390554 RBd76G10 pGCAP10 NM_005313.4  
GAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGC
HKR441791 RBdS104H23 pGCAP10 NM_005313.4  
GACACAGCGGCCCAAGCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGC
HKR452966 RBdS132G22 pGCAP10 NM_005313.4  
TGGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl