Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00283

HP ID(1) HP00283
Gene ID(2) 5684
Gene Symbol finder PSMA3
Protein Name proteasome (prosome, macropain) subunit, alpha type, 3
RefSeq NM_002788.2
Length of RefSeq (bp) 949
Chromosome 14q23
Reference DDBJ accession
UniGene Hs.558799

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08F06 pKA1U5 GGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGC
ARe99B05 pKA1U5 GAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAAT
ARi43E06 pGCAP10 GAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTATGACC
RBd20B10 pGCAP10 GACTAGTTTGCGGCATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCG
RBd46A01 pGCAP10 GGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCT
RBd74H01 pGCAP10 GATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTT
RBd86F11 pGCAP10 GCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTAT
RBd93H01 pGCAP10 GCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTATGACCTGTCAGCCTCTACAT
RBdS083G03 pGCAP10 GGGGCCTGTTACTAGTTTGCGGCATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl