Prev. |  KEGG KO K02727 > 

RIKEN DNA Bank Human Resource - PSMA3

Gene ID NCBI Gene 5684 |  KEGG hsa:5684
Gene Symbol PSMA3
Protein Name proteasome subunit alpha 3
Synonyms HC8|PSC3
Ortholog resources KEGG ortholog (KEGG orthology K02727) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033110 IRAK082M22 pCMV-SPORT6 BC038990 NM_002788 Full
HGY086712 IRAL016M24 pDNR-LIB BC005265 NM_152132 Full
HGY096437 IRAL041B13 pDNR-LIB BC029402 NM_002788 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028871 W01A072C23 pENTR-TOPO IRAL016M24 BC005265 NM_152132  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043326 ARe08F06 pKA1U5 NM_002788.2  
GGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGC
HKR079629 ARe99B05 pKA1U5 NM_002788.2  
GAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAAT
HKR177302 ARi43E06 pGCAP10 NM_002788.2  
GAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTATGACC
HKR368034 RBd20B10 pGCAP10 NM_002788.2  
GACTAGTTTGCGGCATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCG
HKR378401 RBd46A01 pGCAP10 NM_002788.2  
GGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCT
HKR389769 RBd74H01 pGCAP10 NM_002788.2  
GATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTT
HKR394531 RBd86F11 pGCAP10 NM_002788.2  
GCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTAT
HKR397369 RBd93H01 pGCAP10 NM_002788.2  
GCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTATGACCTGTCAGCCTCTACAT
HKR433347 RBdS083G03 pGCAP10 NM_002788.2  
GGGGCCTGTTACTAGTTTGCGGCATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl