Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00276

HP ID(1) HP00276
Gene ID(2) 4904
Gene Symbol finder YBX1
Protein Name Y box binding protein 1
RefSeq NM_004559.3
Length of RefSeq (bp) 1561
Chromosome 1p34
Reference DDBJ accession
UniGene Hs.473583

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66E10 pKA1U5 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
ARe69A12 pKA1U5 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
ARe95D07 pKA1U5 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
ARi40F12 pGCAP10 GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
ARiS023G24 pGCAP10 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
ARiS045F14 pGCAP10 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
ARiS087B02 pGCAP10 AGTTCGATCGGTAGCGGGAGCGGANAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
RBb06H10 pKA1U5 GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
RBb11C01 pKA1U5 GGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACC
RBb27D05 pGCAP1 TGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACC
RBb49A07 pGCAP1 AAATGTGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGTAGAGCCCTGAGCAGC
RBd33C04 pGCAP10 GATTCTCGCTAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCA
RBd42E01 pGCAP10 GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
RBd48C11 pGCAP10 GGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCA
RBd49B11 pGCAP10 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
RBd51A09 pGCAP10 AAAGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCA
RBd54C03 pGCAP10 GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCNTGAGCAGCCCCACCG
RBd60C09 pGCAP10 GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
RBd72E01 pGCAP10 AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
RBdS014E04 pGCAP10 GAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAGCT
RBdS081K21 pGCAP10 GGTGTGCGACGGGGTCCCCTCCCCGCCGACCGGCCTCGTGCGCTCGGGCCCGCACGCCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl