Prev. |  KEGG KO K09276 > 

RIKEN DNA Bank Human Resource - YBX1

Gene ID NCBI Gene 4904 |  KEGG hsa:4904
Gene Symbol YBX1
Protein Name Y-box binding protein 1
Synonyms BP-8|CBF-A|CSDA2|CSDB|DBPB|EFI-A|MDR-NF1|NSEP-1|NSEP1|YB-1|YB1
Ortholog resources KEGG ortholog (KEGG orthology K09276) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001424 IRAK003J08 pCMV-SPORT6 BC038384 NM_004559 Full
HGX056374 IRAK140P14 pCMV-SPORT6 BC065571 NM_004559 Full
HGX066454 IRAK166C06 pCMV-SPORT6 BC071708 NM_004559 Full
HGY067139 IRAK167O03 pBluescriptR BC070084 NM_004559 Full
HGY080734 IRAL001N22 pOTB7 BC002411 NM_004559 Full
HGY083180 IRAL007P20 pOTB7 BC000064 NM_004559 Partial/var
HGY089275 IRAL023D03 pOTB7 BC010430 NM_004559 Full
HGY103391 IRAL058H23 pOTB7 BC072014 NM_004559 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001312 W01A003E16 pENTR-TOPO IRAK003J08 BC038384 NM_004559  
HGE001400 W01A003I08 pENTR-TOPO IRAL023D03 BC010430 NM_004559  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066506 ARe66E10 pKA1U5 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR067612 ARe69A12 pKA1U5 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR078079 ARe95D07 pKA1U5 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR176132 ARi40F12 pGCAP10 NM_004559.3  
GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
HKR209368 ARiS023G24 pGCAP10 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR218134 ARiS045F14 pGCAP10 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR234826 ARiS087B02 pGCAP10 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGANAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR322578 RBb06H10 pKA1U5 NM_004559.3  
GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
HKR324449 RBb11C01 pKA1U5 NM_004559.3  
GGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACC
HKR330877 RBb27D05 pGCAP1 NM_004559.3  
TGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACC
HKR339607 RBb49A07 pGCAP1 NM_004559.3  
AAATGTGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGTAGAGCCCTGAGCAGC
HKR373252 RBd33C04 pGCAP10 NM_004559.3  
GATTCTCGCTAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCA
HKR376897 RBd42E01 pGCAP10 NM_004559.3  
GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
HKR379259 RBd48C11 pGCAP10 NM_004559.3  
GGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCA
HKR379635 RBd49B11 pGCAP10 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR380409 RBd51A09 pGCAP10 NM_004559.3  
AAAGAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCA
HKR381651 RBd54C03 pGCAP10 NM_004559.3  
GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCNTGAGCAGCCCCACCG
HKR384057 RBd60C09 pGCAP10 NM_004559.3  
GAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCG
HKR388897 RBd72E01 pGCAP10 NM_004559.3  
AGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGC
HKR405700 RBdS014E04 pGCAP10 NM_004559.3  
GAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAGCT
HKR432661 RBdS081K21 pGCAP10 NM_004559.3  
GGTGTGCGACGGGGTCCCCTCCCCGCCGACCGGCCTCGTGCGCTCGGGCCCGCACGCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl