Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00237

HP ID(1) HP00237
Gene ID(2) 5725
Gene Symbol finder PTBP1
Protein Name polypyrimidine tract binding protein 1
RefSeq NM_002819.4
Length of RefSeq (bp) 3340
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.172550

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe79C12 pKA1U5 TGAGTTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGT
ARiS049M11 pGCAP10 GATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTG
RBd89B04 pGCAP10 GGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTC
RBdS051E03 pGCAP10 GGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTC
RBdS081D06 pGCAP10 GATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl