Prev. |  KEGG KO K13218 > 

RIKEN DNA Bank Human Resource - PTBP1

Gene ID NCBI Gene 5725 |  KEGG hsa:5725
Gene Symbol PTBP1
Protein Name polypyrimidine tract binding protein 1
Synonyms HNRNP-I|HNRNPI|HNRPI|PTB|PTB-1|PTB-T|PTB2|PTB3|PTB4|pPTB
Ortholog resources KEGG ortholog (KEGG orthology K13218) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04449 SEREX clone BRC-Co-39 #1 SEREX clone BRC-Co-39 #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008611 IRAK021I19 pCMV-SPORT6 BC013694 NM_031990 Full/var
HGY080540 IRAL001F20 pOTB7 BC002397 NM_031990 Full/var
HGY085469 IRAL013L05 pOTB7 BC004383 NM_031991 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092415 M01C031A15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092463 M01C031C15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092511 M01C031E15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092559 M01C031G15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092607 M01C031I15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092655 M01C031K15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092703 M01C031M15 pDONR221 MGC05-A08 BC013694 NM_002819  
HGE092751 M01C031O15 pDONR221 MGC05-A08 BC013694 NM_002819  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071660 ARe79C12 pKA1U5 NM_002819.4  
TGAGTTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGT
HKR219899 ARiS049M11 pGCAP10 NM_002819.4  
GATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTG
HKR395628 RBd89B04 pGCAP10 NM_002819.4  
GGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTC
HKR420499 RBdS051E03 pGCAP10 NM_002819.4  
GGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTC
HKR432478 RBdS081D06 pGCAP10 NM_002819.4  
GATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl