Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00235

HP ID(1) HP00235
Gene ID(2) 5693
Gene Symbol finder PSMB5
Protein Name proteasome (prosome, macropain) subunit, beta type, 5
RefSeq NM_002797.3
Length of RefSeq (bp) 1311
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.422990

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe76G08 pKA1U5 GGCCCACACTAGACATGGCGCTTGCCAGCGTGCCNTTNNAGACCGCTACCGGTGAACCAG
ARi14G08 pGCAP10 GGCATGACCAAAGCCAAGATGGCAGGTACGTCCTTTTAGAATTTAAGGTTAGTGAAGCCA
ARi25A09 pGCAP10 GACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGG
ARi27B11 pGCAP10 GCCTTCTCAAAGATGGCCGACCTCACTTCCCTTANNGACAAGGACGTTTTCAGTCACTTC
ARiS194O18 pGCAP10 GAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTT
RBb04H04 pKA1U5 GGCCCACACTAGACATGGCGCTTGCCAGCGTGCTTGNTNTAGACCGCTACCGGTGAACCA
RBb05A02 pKA1U5 CCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGC
RBb65D12 pGCAP1 GCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGC
RBd01C09 pGCAP10 GTGAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTT
RBd01D05 pGCAP10 GTGAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTT
RBd05C04 pGCAP10 GATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGG
RBd17F11 pGCAP10 GCTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGA
RBd22B04 pGCAP10 TGCTCAGAATTAGTTCTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAG
RBd28H08 pGCAP10 GACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGG
RBd50C07 pGCAP10 GGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGC
RBd77E04 pGCAP10 GAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGGACTTGGGGGTCGTGCAGATCTGCT
RBd87E05 pGCAP10 GTTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGA
RBdS187N23 pGCAP10 GAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl