Prev. |  KEGG KO K02737 > 

RIKEN DNA Bank Human Resource - PSMB5

Gene ID NCBI Gene 5693 |  KEGG hsa:5693
Gene Symbol PSMB5
Protein Name proteasome subunit beta 5
Synonyms LMPX|MB1|X
Ortholog resources KEGG ortholog (KEGG orthology K02737) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY053457 IRAK133K17 pBluescript BC057840 NM_002797 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005267 W01A013C19 pENTR-TOPO IRAK133K17 BC057840 NM_002797  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070552 ARe76G08 pKA1U5 NM_002797.3  
GGCCCACACTAGACATGGCGCTTGCCAGCGTGCCNTTNNAGACCGCTACCGGTGAACCAG
HKR165752 ARi14G08 pGCAP10 NM_002797.3  
GGCATGACCAAAGCCAAGATGGCAGGTACGTCCTTTTAGAATTTAAGGTTAGTGAAGCCA
HKR170009 ARi25A09 pGCAP10 NM_002797.3  
GACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGG
HKR170835 ARi27B11 pGCAP10 NM_002797.3  
GCCTTCTCAAAGATGGCCGACCTCACTTCCCTTANNGACAAGGACGTTTTCAGTCACTTC
HKR277954 ARiS194O18 pGCAP10 NM_002797.3  
GAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTT
HKR321772 RBb04H04 pKA1U5 NM_002797.3  
GGCCCACACTAGACATGGCGCTTGCCAGCGTGCTTGNTNTAGACCGCTACCGGTGAACCA
HKR322002 RBb05A02 pKA1U5 NM_002797.3  
CCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGC
HKR346084 RBb65D12 pGCAP1 NM_002797.3  
GCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGC
HKR360457 RBd01C09 pGCAP10 NM_002797.3  
GTGAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTT
HKR360477 RBd01D05 pGCAP10 NM_002797.3  
GTGAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTT
HKR362052 RBd05C04 pGCAP10 NM_002797.3  
GATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGG
HKR366931 RBd17F11 pGCAP10 NM_002797.3  
GCTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGA
HKR368828 RBd22B04 pGCAP10 NM_002797.3  
TGCTCAGAATTAGTTCTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAG
HKR371376 RBd28H08 pGCAP10 NM_002797.3  
GACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGG
HKR380055 RBd50C07 pGCAP10 NM_002797.3  
GGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGC
HKR390900 RBd77E04 pGCAP10 NM_002797.3  
GAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGGACTTGGGGGTCGTGCAGATCTGCT
HKR394901 RBd87E05 pGCAP10 NM_002797.3  
GTTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGA
HKR475135 RBdS187N23 pGCAP10 NM_002797.3  
GAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl